Daphne miyabeana

Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records237

Data sources10

Biological traits5

DNA specimens9

eDNA detections3

Sources10 archives

Databases and archives Daphne miyabeana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Daphne miyabeana is a species of flowering plant in the family Thymelaeaceae. It is a small, rare evergreen shrub found in rocky areas in the high mountains of Hokkaido and Honshu, Japan. Its leaves are 5–10 cm long by 1–2.5 cm wide, glabrous and dark green above, with a short petiole (stalk). The white flowers are arranged in heads at the end of the current year's growth. Like all daphnes, the flowers have no petals, only petal-like sepals. The sepals form a tube that is 5–6 mm long with spreading lobes. The berries are about 8 mm across and are vermilion when ripe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne miyabeana has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC694844.1 ↗599 bpJapan · 2010

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGC …

Daphne miyabeana TF<JPN>:SKASH017 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Daphne miyabeana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Funabiki 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type237 records

Wild obs. + sensor9

Museum / vouchered228

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 1

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 3≤10 km 20

23 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	39
Nagano City, JP	33
Tomioka, JP	23
Toyama, JP	20
JP	18
Odawara, JP	16
Shinshu Universitylocation not on record	15
Hokkaido University Museumlocation not on record	10
Iwate Prefectural Museumlocation not on record	9
Bando, JP	7
Sanda, JP	6
Fukushima Universitylocation not on record	5
Otaru, JP	4
Sendai, JP	3
Omachi Alpine Museumlocation not on record	3
Forestry and Forest Products Research Institutelocation not on record	3
Kew, GB	1
Nishihara, JP	1
Guangzhou, CN	1
Akita Prefectural Museumlocation not on record	1
SIHUlocation not on record	1

21 institutions · 219 of 228 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Daphne miyabeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.3–22.0

Seasonal swing summer↔winter24.9 °C

Max temp (day)22.2 °C 20.4–25.0

Min temp (night)15.0 °C 12.7–17.9

Precipitation228 mm/mo 196–277

Air humidity65.9 % 63.9–66.5

Moisture balance87.2 mm/mo 69.3–143

Vapour deficit813 Pa 685–898

Wind speed2.20 m/s 1.70–3.10

Cloud cover46.9 % 44.5–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)