Daphne gnidioides

Jaub. & Spach · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records62

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Daphne gnidioides's data was compiled from.

GBIFGlobal Biodiversity Information Facility62 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF62 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass16.67 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition13 compounds

Compounds documented for Daphne gnidioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple coumarins4

Flavones4

Stigmastane steroids2

Daphnane diterpenoids1

Flavonols1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3aR,3bS,3cS,4aR,5S,5aS,8aR,8bR,9R,10aR)-3a,3b,3c,4a,5,5a,8a,9,10,10a-Decahydro-5,5a-dihydroxy-4a-(hydroxymethyl)-7,9-dimethyl-10a-(1-methylethenyl)-2-phenyl-6H-2,8b-epoxyoxireno(6,7)azuleno(5,4-e)-1,3-benzodioxol-6-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
Apiumetrin	present	LOTUS
beta-Amyrin	present	LOTUS
beta-Sitosterol	present	LOTUS
Daphnetin	present	LOTUS
Daphnin	present	LOTUS
Daphnoretin	present	LOTUS
Esculin	present	LOTUS
Isovitexin	present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne gnidioides has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ756472.1 ↗518 bpTurkey · 1984

ACGT

TTGTTGAATCCTGCAAAGCGAAACAACTTGTGAACATGTTTTCAAATGTGTTGAGGGGGGGCTTTGGTGTCATTGGCTCCATCTCCTCTT …

Daphne gnidioides isolate 11E1CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type62 records

Wild obs. + sensor38

Museum / vouchered20

Other4

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 15≤1 km 4≤10 km 3

22 georeferenced · 16 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	16
Saint Louis, US	2
Moscow State Universitylocation not on record	1
Wlocation not on record	1

4 institutions · 20 of 20 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)