Daphne glomerata

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records640

Data sources8

Biological traits16

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Daphne glomerata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility640 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF640 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Daphne glomerata is a shrub, of the family Thymelaeaceae. It is evergreen, and is found in Turkey and Caucasus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.5 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flowering endJul

Flowering startMay

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTmeadows, mountains

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne glomerata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ756506.1 ↗558 bpArmenia · 2005

ACGT

AAGCAGAACAACCCGTGAACATGTTTGCAAATGTGTTGAGGGGGATTGGAGTCATTGGCTCCATCTCCTCTCGACTGGCCCGTGTGGCCA …

Daphne glomerata isolate 7E3CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Daphne glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — COKOHOBCKaH, CTpenKOBa 1940, 19486

CCDB · book-atlas-flowering-plants — S. & S. 1940

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type640 records

Wild obs. + sensor503

Museum / vouchered134

Cultivated / captive2

Other1

Range

Area of Occupancy AOO1 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 224≤1 km 80≤10 km 36>10 km 15

355 georeferenced · 148 without coordinates

Open the mapobservation + sensor503

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 4≤1 km 11≤10 km 48>10 km 1

64 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence134

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	99
Salamanca, ES	5
BRNUlocation not on record	4
Wlocation not on record	4
MAlocation not on record	3
València, ES	3
Edinburgh, GB	3
Saint Louis, US	2
Bronx, US	1
Voronezh State Universitylocation not on record	1
Berlin, DE	1
Kew, GB	1
Durham, US	1
BClocation not on record	1
University of Stellenboschlocation not on record	1

15 institutions · 130 of 134 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)