Daphne blagayana

Freyer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records128

Data sources11

Biological traits14

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Daphne blagayana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS16 compounds

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT2.3 Gbp

01Narrative

Daphne blagayana est une espèce de plante appartenant à la famille des Thymelaeaceae. On la rencontre en Albanie, en Bulgarie, dans les pays de l'ex-Yougoslavie, en Grèce et en Roumanie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.25 m

Plant height max0.3 m

Life cycle & reproduction6

Deciduousnessevergreen

Flowering endJun

Flowering startApr

Life formsubshrub

Life spanwoody

⚠ sources differ — TRY: woody · GIFT: perennial

Raunkiær life formphanerophyte

Habitat & environment5

Aquaticterrestrial

Climatetemperate

Growth formshrub

Habitat GIFTgarden

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition16 compounds

Compounds documented for Daphne blagayana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furofuranoid lignans2

Quinoline alkaloids2

Cinnamic acid amides2

Lupane triterpenoids2

Stigmastane steroids2

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Epieudesmin	present	NPASS
(1S,6S)-6-(1,3-benzodioxol-5-yl)-3-(4-methylpent-3-enyl)-N-(2-methylpropyl)cyclohex-3-ene-1-carboxamide	present	NPASS
8-Methoxy-9-Methylfuro(2,3-B)Quinolin-4-One	present	NPASS
Arctigenin methyl ether	present	NPASS
Arnottianamide	present	NPASS
beta-Sitosterol	present	NPASS
Fagaramide	present	NPASS
Heitziamide B	present	NPASS
Heitziethanoid A	present	NPASS
Heitziethanoid B	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne blagayana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ756496.1 ↗557 bpSlovenia · 2009

ACGT

TTGTGAACATGTTTGCAAATGTGTTGAGGGGGCTTGGTGTCATTGGCTCCATCTCCTCTCAACTGGCTCATGTGGCCAAGATAACCAACC …

Daphne blagayana isolate 10E4CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Daphne blagayana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 298 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Daphne blagayana2.3 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Nevling, 1962

CCDB · ipcn-api-dl — Van Loon, J. C. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 763–764.

CCDB · book-fedorov — Elaise 1959

CCDB · book-fedorov — Nevling 1962

CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213

CCDB · Cave1962 — Nevling 1962a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type128 records

Wild obs. + sensor120

Museum / vouchered7

Cultivated / captive1

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 49≤1 km 11≤10 km 7>10 km 10

77 georeferenced · 43 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence7

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record	2
Podgorica, ME	1
BRNUlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Bloomington, US	1

5 institutions · 6 of 7 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Daphne blagayana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)