Daphne bholua

Buch.-Ham. ex D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records347

Data sources11

Biological traits24

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Daphne bholua's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility347 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionLOTUS177 compounds

Occurrence & distributionGBIF347 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Daphne bholua, the Nepalese paper plant, is a species of flowering shrub in the genus Daphne of the family Thymelaeaceae. It grows at altitudes of 1700 - in the Himalayas and neighbouring mountain ranges, from Nepal to southern China. At lower altitudes it is found as an evergreen in thickets and forest margins; at higher altitudes, it is deciduous and is usually found in pastures and grassy glades. It usually reaches a height of about 2.5 m, though some specimens reach 4 m or more. Daphne bholua has leathery leaves and deep pink flowers with a powerful fragrance, and a number of named cultivars have been bred and are grown as garden plants in Europe and North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length7 mm

Fruit length max7 mm

Fruit length min7 mm

Leaf length110 mm

Leaf length max170 mm

Leaf length min50 mm

Leaf width24.5 mm

Leaf width max32 mm

Leaf width min17 mm

Plant height1.77 m

Plant height max2.6 m

Plant height min1 m

Life cycle & reproduction3

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 400 m

Elevation min1 300 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition177 compounds

Compounds documented for Daphne bholua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids23

Hydrocarbons19

Wax monoesters15

Daphnane diterpenoids11

Fatty aldehydes8

Documented compounds177 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(+)-Pinoresinol	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-Wikstromol	present	LOTUS
(1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(1R,5S,13R)-1,9,17,19-tetrahydroxy-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.8.0.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaen-21-one	present	LOTUS
(1R,5S,6R,13S)-1,6,9,17,19-pentahydroxy-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.8.0.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaen-21-one	present	LOTUS
(1S,5R,13S)-9,17,19-trihydroxy-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.8.0.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaen-21-one	present	LOTUS
(1S,5S,13R)-1,9,17,19-tetrahydroxy-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.8.0.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaen-21-one	present	LOTUS
(1S,5S,6R,13R)-1,6,9,17,19-pentahydroxy-5,13-bis(4-hydroxyphenyl)-4,12,14-trioxapentacyclo[11.8.0.02,11.03,8.015,20]henicosa-2(11),3(8),9,15,17,19-hexaen-21-one	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne bholua has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ756477.1 ↗572 bpChina · 2004

ACGT

TTGTCGAATCCTGCAAAGCAGAACAACCTGTGAACATGTTTACAAATGTGTTGAGGGGGCTTGGCGTCATTGGCTCCATCTCCTCTCGAC …

Daphne bholua isolate 14E1CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Daphne bholua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records18–302n range28median28mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 286×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · CCDB · Cave1958

CCDB · book-fedorov — Osawa 19f3a

CCDB · book-fedorov — Takenaka 1931b

CCDB · book-fedorov — D. 1955)

CCDB · book-fedorov — Hiraoka 1958

CCDB · book-atlas-flowering-plants — Takenaka 1931

CCDB · Cave1958 — Hiraoka 1958

2n 273×CCDB · book-fedorov · CCDB · Cave1959

CCDB · book-fedorov — Okura, Kono 1959

CCDB · book-fedorov — I. 1959)

CCDB · Cave1959 — Okura and Kono 1959

2n 303×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Yamaha 1927

CCDB · book-fedorov — Hosono (Kihara et al. 1931)

CCDB · book-atlas-flowering-plants — Yamaha, K. 1931

2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Elaise 1959

CCDB · book-atlas-flowering-plants — Venkateswarlu 1946

n 141×CCDB · Cave1958

CCDB · Cave1958 — Hiraoka 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type347 records

Wild obs. + sensor231

Museum / vouchered104

Cultivated / captive1

Other11

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 85≤1 km 39≤10 km 24>10 km 7

155 georeferenced · 76 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence104

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	34
CASlocation not on record	15
Kunming, CN	12
Saint Louis, US	7
Edinburgh, GB	5
Natural History Museum, Tribhuvan Universitylocation not on record	4
Chengdu, CN	4
Fort Worth, US	4
Taipei, TW	2
Kew, GB	2
Auckland, NZ	2
University of Stellenboschlocation not on record	2
Christchurch, NZ	2
Bronx, US	1
Kathmandu, NP	1
Minia, EG	1
Rotorua, NZ	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Elocation not on record	1
云南省思茅市民族传统医药研究所location not on record	1

20 institutions · 102 of 104 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Daphne bholua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)