Daphne altaica

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records59

Data sources9

Biological traits24

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Daphne altaica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources24 traits

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Daphne altaica is a shrub, of the family Thymelaeaceae. It is deciduous, and is found across Asia, including in parts of Russia, Mongolia, and China. It is found at elevations of about 1000 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology11

Fruit length6 mm

Fruit length max7 mm

Fruit length min5 mm

Leaf length42.5 mm

Leaf length max55 mm

Leaf length min30 mm

Leaf width max12 mm

Leaf width min8 mm

Plant height50 m

Plant height max60 m

Plant height min0.4 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flowering endJun

Flowering startMay

Life formshrub

Life spanperennial

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation mean1 000 m

Elevation min1 000 m

Growth formshrub

Habitat GIFTgarden,shrubberies,steppe

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne altaica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes5

GenBank sequences8

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP785380.1 ↗288 bp

ACGT

TATTATAAAGAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAG …

Daphne altaica voucher ALT23-175 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type59 records

Wild obs. + sensor8

Museum / vouchered51

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1≤10 km 1

6 georeferenced · 2 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤1 km 13≤10 km 9>10 km 2

24 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	20
Shanghai, CN	7
Urumqi, CN	5
Yangling, CN	3
Xining, CN	1
BRNUlocation not on record	1

6 institutions · 37 of 51 vouchered records shown · 14 without an institution code

09Environmental DNA1 detections

Where the DNA of Daphne altaica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Bushes

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.2 °C 23.2–23.2

Seasonal swing summer↔winter35.7 °C

Max temp (day)28.8 °C

Min temp (night)17.1 °C

Precipitation21.1 mm/mo

Air humidity46.0 %

Moisture balance-165 mm/mo

Vapour deficit1,538 Pa

Wind speed4.50 m/s

Cloud cover31.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)