Daphne alpina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Daphne

At a glance

Occurrence records6 490

Data sources7

Biological traits17

DNA specimens2

eDNA detections0

Sources7 archives

Databases and archives Daphne alpina's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 490 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF6 490 records

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT4 Gbp

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology3

Plant height0.5 m

Plant height max0.6 m

Plant height min0.2 m

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typeanimal

Flowering endJun

Flowering startMay

Life formsubshrub

Life spanwoody

⚠ sources differ — TRY: woody · GIFT: perennial

Lifespan years20 years

Raunkiær life formphanerophyte

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphne alpina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ756528.1 ↗573 bpSpain · 2006

ACGT

TTGTCGAGTCCTGCAAAGCAGAACAACCTGTGAACATGTTTGCAAATGTGTTGAGGGGGCTTGGTGTCATTGGCTCCATCTCCTCTCGAC …

Daphne alpina isolate 16E5CR21 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Daphne alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 995 130 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Daphne alpina4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type6 490 records

Wild obs. + sensor6 258

Museum / vouchered219

Cultivated / captive5

Other8

Range

Area of Occupancy AOO5 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy16% within 1 km

≤100 m 613≤1 km 288≤10 km 4 679>10 km 122

5 702 georeferenced · 556 without coordinates

Open the mapobservation + sensor6 258

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 7≤1 km 31≤10 km 85>10 km 1

124 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence219

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bern, CH	49
Zürich, CH	35
Zürich, CH	24
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	15
Porrentruy, CH	14
Adam Mickiewicz University in Poznańlocation not on record	8
BDBClocation not on record	7
Barcelona, ES	6
BRNUlocation not on record	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Salzburg, AT	2
CJBGlocation not on record	2
Denver, US	2
BClocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
LDlocation not on record	2
BIO-UNIPIlocation not on record	2
Bourges, FR	2
Boumlocation not on record	1
MAlocation not on record	1
GJOlocation not on record	1
Provincia di Livornolocation not on record	1
Fribourg, CH	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Saint Louis, US	1
CICYTEXlocation not on record	1
PRClocation not on record	1
Oskarshamn, SE	1
Québec, CA	1

29 institutions · 196 of 219 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Daphne alpina

At a glance

Sources7 archives

Size & morphology3

Life cycle & reproduction8

Habitat & environment5

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type6 490 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 29 geolocated

Cultivated / Captivenot free-living

Record type6 490 records