Daphnandra apatela

Schodde · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Atherospermataceae/Daphnandra

At a glance

Occurrence records1 204

Data sources9

Biological traits34

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Daphnandra apatela's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 204 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF1 204 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Daphnandra apatela, the socketwood, light yellowwood or canary socketwood is a common rainforest tree in eastern Australia. It grows in the more fertile alluvial soils and basaltic soils. Distributed from the Watagan Mountains (31° S) in New South Wales to Miriam Vale (24° S) near Gladstone in Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length5 mm

Leaf length94.5 mm

Leaf length max150 mm

Leaf length min60 mm

Leaf mass89.33 mg

Leaf mass per area46.53 g/m2

Leaf size2 938 mm²

⚠ sources differ — TRY: 2 938 mm² · AusTraits: 2 293 mm²

Leaf width36 mm

Leaf width max40 mm

Leaf width min15 mm

Petiole length0.55 cm

Plant height30 m

Seed length7.5 mm

Seed mass3.84 mg

Seed width2.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnyyynn

Life formtree

Life spanperennial

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formtree

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical ovate

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)18.96 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Daphnandra apatela across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Kaurane and Phyllocladane diterpenoids6

Isoquinoline alkaloids4

Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids2

Bisabolane sesquiterpenoids1

Aromadendrane sesquiterpenoids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1,2-Dehydrotelobine	present	LOTUS
(-)-alpha-Curcumene	present	NPASS
(1aS,4aR,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	NPASS
(1S,4R,6R,10R)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1S,4S,5R,9S,10R,13R)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-5-ol	present	NPASS
(1S,4S,5S,9S,10R,13R)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-5-ol	present	NPASS
(8R,21S)-13,27-dimethoxy-22-methyl-15,29,31-trioxa-7,22-diazaoctacyclo[19.9.3.216,19.14,30.110,14.03,8.025,33.028,32]heptatriaconta-1(30),2,4(34),10(37),11,13,16,18,25,27,32,35-dodecaene	present	LOTUS
Apateline	present	LOTUS
Dehydroapateline	present	LOTUS
ent-17-Hydroxykaur-15-en-19-oic acid	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daphnandra apatela has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU564789.1 ↗379 bpAustralia

ACGT

AGATACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCCGGAGTTCCACCTGAGGAAGCAGGGGCTGCTGTAGCTGCCGAATCTTC …

Daphnandra apatela ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type1 204 records

Wild obs. + sensor842

Museum / vouchered331

Cultivated / captive2

Other29

Origin

Native70

Introduced1

Range

Area of Occupancy AOO2 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 785≤1 km 11≤10 km 6>10 km 1

803 georeferenced · 39 without coordinates

Open the mapobservation + sensor842

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 51≤1 km 37≤10 km 132>10 km 65

285 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence331

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	83
Mount Annan, AU	71
Canberra, AU	65
Museo Entomologico de Leonlocation not on record	55
Armidale, AU	27
John T. Waterhouse Herbariumlocation not on record	13
Smithfield, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Boise, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Hobart, AU	1
Kensington, AU	1
University of Stellenboschlocation not on record	1

13 institutions · 326 of 331 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Daphnandra apatela was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 20.1–20.1

Seasonal swing summer↔winter9.00 °C

Max temp (day)23.0 °C

Min temp (night)17.4 °C

Precipitation113 mm/mo

Air humidity60.3 %

Moisture balance-4.80 mm/mo

Vapour deficit936 Pa

Wind speed2.30 m/s

Cloud cover25.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Daphnandra apatela

At a glance

Sources9 archives

Size & morphology15

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds18 total

At a glance

Record type1 204 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 204 records