Daniellia oliveri

(Rolfe) Hutch. & Dalziel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Daniellia

At a glance

Occurrence records6 130

Data sources12

Biological traits28

DNA specimens4

eDNA detections3

Sources12 archives

Databases and archives Daniellia oliveri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 130 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF6 130 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Daniellia oliveri is a species of tree in the family Fabaceae. It is native to tropical West and Central Africa and is commonly known as the African copaiba balsam tree, or the West African copal tree.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf size3 403 mm²

Plant height20 m

Plant height max30.48 m

Seed mass1 234 mg

Seed mass max1 272 mg

Seed mass min1 197 mg

Seed volume9 600 mm³

Seed volume max9 600 mm³

Seed volume min9 600 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Top.Canopy.Tree

Woodinesswoody

Physiology & chemistry7

Leaf c487 mg/g

Leaf n15.61 mg/g

Leaf p1.03 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.38 mm²/mg

Wood density493 mg/cm³

03Chemical composition51 compounds

Compounds documented for Daniellia oliveri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cadinane sesquiterpenoids10

Flavonols5

Germacrane sesquiterpenoids4

Aromadendrane sesquiterpenoids2

Bicyclogermacrane sesquiterpenoids $ Cyclogermacrane sesquiterpenoids2

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	LOTUS
(-)-Caryophyllene	present	LOTUS
(-)-Cyperene	present	LOTUS
(-)-gamma-Cadinene	present	LOTUS
(1S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	LOTUS
(1S,2S,6S,7R,8R)-1,3-dimethyl-8-propan-2-yltricyclo[4.4.0.02,7]dec-3-ene	present	LOTUS
(S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene	present	LOTUS
1,2,4,6-Tetrathiepane	present	NPASS
1-Hydroxy-1,7-dimethyl-4-isopropyl-2,7-cyclodecadiene	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daniellia oliveri has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN992819.1 ↗535 bp

ACGT

GCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGG …

Daniellia oliveri voucher K:Myers 7905 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcLa★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type6 130 records

Wild obs. + sensor5 660

Museum / vouchered267

Other203

Range

Area of Occupancy AOO9 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 308≤1 km 7≤10 km 2>10 km 17

334 georeferenced · 5 326 without coordinates

Open the mapobservation + sensor5 660

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence267

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LSF/FSA/UAClocation not on record	27
Frankfurt am Main	22
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	19
Yaoundé, CM	17
LSFlocation not on record	16
Saint Louis, US	16
Leiden University Medical Centerlocation not on record	12
HNBlocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	10
Université du Lomélocation not on record	10
Kew, GB	7
CNF-UFHBlocation not on record	5
BRLUlocation not on record	4
EFGlocation not on record	4
MAlocation not on record	4
Paris, FR	3
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	3
Xiamen, CN	3
Forest Herbarium Ibadan (FHI)location not on record	3
Pretoria, ZA	2
Herbier National du Gabonlocation not on record	2
MeiseBGlocation not on record	2
Berlin, DE	1
Plocation not on record	1
South Kensington, GB	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1

28 institutions · 208 of 267 vouchered records shown · 59 without an institution code

09Environmental DNA3 detections

Where the DNA of Daniellia oliveri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.1 °C 29.1–29.1

Seasonal swing summer↔winter3.50 °C

Max temp (day)35.0 °C

Min temp (night)24.2 °C

Precipitation113 mm/mo

Air humidity57.6 %

Moisture balance-58.8 mm/mo

Vapour deficit1,701 Pa

Wind speed2.10 m/s

Cloud cover21.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Daniellia oliveri

At a glance

Sources12 archives

Size & morphology9

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry7

Compound class profile5 classes

Documented compounds51 total

At a glance

Record type6 130 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 130 records