Daniellia ogea

(Harms) Rolfe ex Holland · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Daniellia

At a glance

Occurrence records102

Data sources11

Biological traits16

DNA specimens6

eDNA detections5

Sources11 archives

Databases and archives Daniellia ogea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Daniellia ogea est une espèce de plantes à fleurs de la famille des Fabaceae, qui a pour noms vernaculaires arbre à encens, faro d’Agboville, accra copal, Benin gum copal, gum copal tree. C'est un arbre de taille moyenne à grande. L’espèce est répandue en Afrique de l’Ouest et en Afrique Centrale, Sénégal jusqu’au Cameroun et au Gabon.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height40 m

⚠ sources differ — GIFT: 40 m · TRY: 35 m

Plant height max54.86 m

Life cycle & reproduction4

DeciduousnessDeciduous or evergreen broad-leaved

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density433 mg/cm³

03Chemical composition11 compounds

Compounds documented for Daniellia ogea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavanones5

Labdane diterpenoids $ Norlabdane diterpenoids2

Lanostane, Tirucallane and Euphane triterpenoids1

Labdane diterpenoids1

Friedelane triterpenoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4aR,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[(2E)-3-methylpenta-2,4-dienyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
(2R)-8-[(2R,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-5,7-dihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	NPASS
(2S)-8-[(2S,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-3-yl]-2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	NPASS
(2S)-eriodictoyl-7-O-beta-D-glucopyranosiduronic acid	present	NPASS
1,4a-dimethyl-6-methylidene-5-(3-methylpenta-2,4-dienyl)-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	LOTUS
[(1S,4aR,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[(2Z)-3-methylpenta-2,4-dienyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalen-1-yl]methanol	present	LOTUS
Amentoflavone	present	NPASS
Friedelin	present	NPASS
Lanosterol	present	NPASS
methyl (2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[[(2R)-5-hydroxy-2-(4-hydroxyphenyl)-4-oxo-2,3-dihydrochromen-7-yl]oxy]oxane-2-carboxylate	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Daniellia ogea has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN992814.1 ↗761 bp

ACGT

GGCGGTTCGCTGCCGACGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAAC …

Daniellia ogea voucher K:Limbe Botanical Garden 34985 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor19

Museum / vouchered80

Other3

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 19 records without

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence80

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	7
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	7
Leiden University Medical Centerlocation not on record	5
Paris, FR	4
LBVlocation not on record	4
Herbier National du Gabonlocation not on record	4
HNBlocation not on record	3
WAGlocation not on record	3
University of Stellenboschlocation not on record	3
BRLUlocation not on record	2
Plocation not on record	2
CNF-UFHBlocation not on record	1
Xiamen, CN	1
MAlocation not on record	1
Forest Herbarium Ibadan (FHI)location not on record	1
Stockholm, SE	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

20 institutions · 53 of 80 vouchered records shown · 27 without an institution code

09Environmental DNA5 detections

Where the DNA of Daniellia ogea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 27.7–27.7

Seasonal swing summer↔winter3.30 °C

Max temp (day)32.6 °C

Min temp (night)23.9 °C

Precipitation114 mm/mo

Air humidity63.6 %

Moisture balance-46.0 mm/mo

Vapour deficit1,348 Pa

Wind speed2.30 m/s

Cloud cover26.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)