Dampiera wellsiana

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records294

Data sources9

Biological traits24

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Dampiera wellsiana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility294 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF294 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Dampiera wellsiana is a herb in the family of Goodeniaceae and is one of approximately 70 species of Dampiera.Ghisalberti, E. L. (2004). The Goodeniaceae. Fitoterapia, [online] 75(5), pp.429–446. [Accessed 22 Mar. 2021]. Dampiera wellsiana is native to Western Australia.George, A. S. and Australian Biological Resources Study (1992). Flora of Australia. Volume 35, Brunoniaceae, Goodeniaceae. [online] Canberra: Australian Govt. Pub. Service. [Accessed 22 Mar. 2021]. It is a non-threatened, stoloniferous plant and is often defined by its small blue petals and the arid climate it grows in. Botanist Ferdinand von Mueller first described the plant in 1876.Puccio, P. and Beltramini, M. (n.d.). Dampiera wellsiana. [online] Monaco Nature Encyclopedia. [Accessed 21 Mar. 2021].

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length2 mm

Leaf length45 mm

Leaf width24.5 mm

Petiole length6 cm

Plant height0.25 m

Plant height max0.25 m

Plant height min0.05 m

Seed mass0.974 mg

Life cycle & reproduction5

Flowering timennnnnnnyyyyn

Life formperennial

Life spanperennial

Lifespan years6 years

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typenut

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera wellsiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKJQ711624.1 ↗1 565 bpAustralia

ACGT

TGTATAAGAAACAGTATATTGATAAAAAATTTCCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTTCTAACCATCTTGTTAT …

Dampiera wellsiana voucher UPS Gustafsson &38 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dampiera wellsiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Peacock 1963

CCDB · Cave1963 — PeacocK 1963

n 92×CCDB · Cave1963

CCDB · Cave1963 — Peacock 1963

CCDB · Cave1963 — PeacocK 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type294 records

Wild obs. + sensor65

Museum / vouchered226

Cultivated / captive3

Origin

Native12

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 24≤1 km 9≤10 km 3>10 km 5

41 georeferenced · 24 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 22≤1 km 13≤10 km 131>10 km 16

182 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence226

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	119
Museo Entomologico de Leonlocation not on record	32
Canberra, AU	31
Adelaide, AU	18
Mount Annan, AU	11
BGPAlocation not on record	4
Claremont, US	4
Uppsala, SE	2
Brisbane, AU	2
AUAlocation not on record	1
Kew, GB	1

11 institutions · 225 of 226 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dampiera wellsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)