Dampiera stricta

(Sm.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records14 248

Data sources8

Biological traits42

DNA specimens4

eDNA detections2

Sources8 archives

Databases and archives Dampiera stricta's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility14 248 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Occurrence & distributionGBIF14 248 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Dampiera stricta commonly known as blue dampiera, is a flowering plant in the family Goodeniaceae. It is a small sub-shrub with variable leaves and mostly blue, mauve or purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length5 mm

Leaf length45 mm

Leaf length max45 mm

Leaf length min60 mm

Leaf mass8.9 mg

Leaf mass per area157 g/m2

Leaf size64.0 mm²

Leaf width3.5 mm

Leaf width max19 mm

Leaf width min2 mm

Plant height0.6 m

⚠ sources differ — AusTraits: 0.6 m · TRY: 0.35 m

Plant height max0.9 m

Plant height min0.2 m

Seed length4 mm

Seed mass5.74 mg

Seed width2 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeanimal

Flowering endJan

Flowering startAug

Flowering timeynnnnnnyyyyy

Life formperennial

Life spanperennial

Lifespan years100 years

Pollination syndromeinsect

Reproductive maturity3 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate linear

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.27 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera stricta has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594188.1 ↗615 bpAustralia · 2018

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCGGAC …

Dampiera stricta voucher 600400436 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Dampiera stricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Jackson W. D. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type14 248 records

Wild obs. + sensor13 232

Museum / vouchered979

Cultivated / captive5

Other32

Origin

Native208

Range

Area of Occupancy AOO16 440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 10 302≤1 km 1 380≤10 km 456>10 km 92

12 230 georeferenced · 1 002 without coordinates

Open the mapobservation + sensor13 232

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 71≤1 km 159≤10 km 534>10 km 79

843 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence979

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	210
Museo Entomologico de Leonlocation not on record	200
Canberra, AU	194
Armidale, AU	65
Hobart, AU	64
Adelaide, AU	61
Brisbane, AU	46
John T. Waterhouse Herbariumlocation not on record	26
Wollongong, AU	24
Kew, GB	13
QVMAGlocation not on record	11
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Palmerston, AU	7
Parkville, AU	6
La Trobe Universitylocation not on record	4
Batemans Bay, AU	4
Smithfield, AU	3
Kensington, AU	3
LDlocation not on record	3
Auckland, NZ	2
Claremont, US	2
Stockholm, SE	2
Uppsala, SE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Cambridge University Herbariumlocation not on record	1
Wuzhou, CN	1
Moscow State Universitylocation not on record	1
Xiamen, CN	1
US	1
Wellington, NZ	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Edinburgh, GB	1

32 institutions · 969 of 979 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Dampiera stricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 20.4–21.7

Seasonal swing summer↔winter14.4 °C

Max temp (day)27.2 °C 26.2–28.2

Min temp (night)15.2 °C 15.0–15.4

Precipitation46.3 mm/mo 21.7–70.9

Air humidity51.1 % 44.9–57.2

Moisture balance-103 mm/mo -135–-71.4

Vapour deficit1,301 Pa 1,043–1,559

Wind speed3.20 m/s 2.60–3.80

Cloud cover18.4 % 18.2–18.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dampiera stricta

At a glance

Sources8 archives

Size & morphology16

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type14 248 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 248 records