Dampiera purpurea

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records2 867

Data sources7

Biological traits39

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Dampiera purpurea's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 867 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF2 867 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Dampiera purpurea, commonly known as the mountain- or purple dampiera, is a subshrub in the family Goodeniaceae native to Victoria, New South Wales and Queensland in eastern Australia. Its blue-purple flowers appear in spring and early summer (September to December), and it is pollinated by insects such as butterflies and bees. Adapting readily to cultivation, Dampiera purpurea is grown as a garden plant in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length4.5 mm

Leaf length60 mm

Leaf length max60 mm

Leaf length min9 mm

Leaf mass19.45 mg

Leaf mass per area138 g/m2

Leaf size149 mm²

Leaf width42 mm

Leaf width max42 mm

Leaf width min5 mm

Plant height1 m

Plant height max1 m

Seed length4 mm

Seed mass5.07 mg

Seed width1.76 mm

Life cycle & reproduction10

Dispersal typeanimal

Flowering endJan

Flowering startAug

Flowering timeynnnnnnyyyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Reproductive maturity2.5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera purpurea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKJQ711647.1 ↗1 582 bpAustralia

ACGT

TGTGTGTGTATAAGAAACAGTATATTGATAAAAAAATTTCCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAAGATTTCTAACCATT …

Dampiera purpurea voucher AAU R. Coverny 11373 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Dampiera purpurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 867 records

Wild obs. + sensor2 278

Museum / vouchered576

Cultivated / captive6

Other7

Origin

Native157

Range

Area of Occupancy AOO5 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 699≤1 km 209≤10 km 97>10 km 20

2 025 georeferenced · 253 without coordinates

Open the mapobservation + sensor2 278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 95≤1 km 82≤10 km 284>10 km 64

525 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence576

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 1≤10 km 2

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	157
Canberra, AU	119
Brisbane, AU	89
Museo Entomologico de Leonlocation not on record	85
NSW Dept of Planning, Industry and Environmentlocation not on record	18
Wollongong, AU	18
Adelaide, AU	18
John T. Waterhouse Herbariumlocation not on record	16
Armidale, AU	15
Batemans Bay, AU	10
Hobart, AU	6
Kew, GB	5
Kensington, AU	2
Canadian Department of Agriculturelocation not on record	2
GJOlocation not on record	1
Xiamen, CN	1
Auckland, NZ	1
Palmerston, AU	1
La Trobe Universitylocation not on record	1
Smithfield, AU	1

20 institutions · 566 of 576 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dampiera purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dampiera purpurea

At a glance

Sources7 archives

Size & morphology15

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 867 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 867 records