Dampiera linearis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records2 047

Data sources8

Biological traits28

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Dampiera linearis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 047 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF2 047 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Dampiera linearis, commonly known as common dampiera or wedge-leaved dampiera, is an erect perennial herb in the family Goodeniaceae. The species, which is endemic to the south-west of Western Australia, grows to between 15 and 60 cm (6 in–2 ft) high, with its blue to purple flowers appearing between July and December. It adapts readily to cultivation, particularly containers such as hanging baskets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology9

Fruit length5 mm

Leaf length26.15 mm

Leaf mass per area229 g/m2

Leaf size64.37 mm²

Leaf width5.7 mm

Plant height0.6 m

Plant height max0.6 m

Plant height min0.15 m

Seed mass4.05 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnnyyyyn

Life formperennial

Life spanperennial

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Shrub

Leaf compoundnesssimple

Leaf shapeelliptical obovate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera linearis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKJQ711680.1 ↗1 536 bpAustralia

ACGT

TTCCAAATCAAAAGAGCGATTGGGTTGAAAAAAATAAAAGATTTCTAACCATTTTGTTATCCTATATCGAAAACGAATAGAAATTTTGAA …

Dampiera linearis voucher UPS Gustafsson &38 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dampiera linearis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records54–542n range54median54mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 542×CCDB · book-fedorov · CCDB · Cave1963

CCDB · book-fedorov — Peacock 1963

CCDB · Cave1963 — Peacock 1963

n 271×CCDB · Cave1963

CCDB · Cave1963 — Peacock 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 047 records

Wild obs. + sensor880

Museum / vouchered1 167

Origin

Native79

Range

Area of Occupancy AOO3 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 549≤1 km 249≤10 km 17>10 km 11

826 georeferenced · 54 without coordinates

Open the mapobservation + sensor880

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 88≤1 km 26≤10 km 711>10 km 233

1 058 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence1 167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	795
Museo Entomologico de Leonlocation not on record	175
Canberra, AU	74
Mount Annan, AU	41
Adelaide, AU	28
Brisbane, AU	10
Claremont, US	7
BGPAlocation not on record	7
Kew, GB	6
Hobart, AU	5
MAlocation not on record	3
Joondalup, AU	3
Uppsala, SE	3
Armidale, AU	2
LDlocation not on record	2
Smithfield, AU	2
Phoenix, US	1

17 institutions · 1 164 of 1 167 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Dampiera linearis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dampiera linearis

At a glance

Sources8 archives

Size & morphology9

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 047 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 047 records