Dampiera dysantha

(Benth.) Rajput & Carolin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records1 119

Data sources6

Biological traits22

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Dampiera dysantha's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 119 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF1 119 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dampiera dysantha, the shrubby dampiera, is an undershrub in the family Goodeniaceae. The species grows to 70 cm high The flowers are blue, or occasionally white to lilac and are covered on the outside with grey and rusty hairs. These generally appear between September and October in its native range. The species was first formally described as a variety of Dampiera rosmarinifolia by English botanist George Bentham in Flora Australiensis in 1868.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Fruit length3 mm

Leaf length16 mm

Leaf width5 mm

Plant height0.7 m

Plant height max0.7 m

Life cycle & reproduction7

Dispersal typeanimal+self

Flowering timeynnnnnnnyyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typenut

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: subshrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera dysantha has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKJQ711639.1 ↗1 564 bpAustralia

ACGT

TATAAGAAACAGTATATTGATAAAAAATTTCCAAAATCAAAAGAGCGATTGGGTTGAAAAAATAAAGGATTTCTAACCATCTTGTTATCC …

Dampiera dysantha voucher CANB 0051703 Whibley 10005 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type1 119 records

Wild obs. + sensor752

Museum / vouchered367

Origin

Native347

Range

Area of Occupancy AOO2 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 339≤1 km 176≤10 km 131>10 km 6

652 georeferenced · 100 without coordinates

Open the mapobservation + sensor752

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 45≤1 km 66≤10 km 211>10 km 34

356 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	208
Museo Entomologico de Leonlocation not on record	102
Canberra, AU	20
Hobart, AU	5
Mount Annan, AU	2
Stockholm, SE	2
La Trobe Universitylocation not on record	2
Brisbane, AU	1
Claremont, US	1
Smithfield, AU	1
Palmerston, AU	1
MeiseBGlocation not on record	1
Auckland, NZ	1

13 institutions · 347 of 367 vouchered records shown · 19 without an institution code

09Environmental DNA1 detections

Where the DNA of Dampiera dysantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dampiera dysantha

At a glance

Sources6 archives

Size & morphology5

Life cycle & reproduction7

Habitat & environment7

Physiology & chemistry2

Other traits1

At a glance

Record type1 119 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 119 records