Dampiera adpressa

A.Cunn. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Goodeniaceae/Dampiera

At a glance

Occurrence records552

Data sources7

Biological traits29

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Dampiera adpressa's data was compiled from.

GBIFGlobal Biodiversity Information Facility552 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF552 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Fruit length4.5 mm

Leaf length33 mm

Leaf width12.5 mm

Leaf width max23 mm

Leaf width min2 mm

Plant height1 m

Life cycle & reproduction9

Dispersal typeanimal

Flowering endJan

Flowering startJun

Flowering timeynnnnyyyyyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate narrowly_oblong ovate

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dampiera adpressa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKJQ711563.1 ↗834 bpAustralia

ACGT

TTGGTTCAAGCTCTTCGCTATTGGATAAAAGATGCTGCCTCTTTACATTTATTAAGATTTTTTCTCCATGGCTGTCCTAATTTTGACAGT …

Dampiera adpressa voucher CBG 9102768 Telford 11442 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dampiera adpressa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · Cave1963

CCDB · Cave1963 — Peacock 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type552 records

Wild obs. + sensor237

Museum / vouchered292

Other23

Origin

Native50

Range

Area of Occupancy AOO1 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 219≤1 km 9≤10 km 6>10 km 1

235 georeferenced · 2 without coordinates

Open the mapobservation + sensor237

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 93≤1 km 27≤10 km 116>10 km 30

266 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence292

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	127
Mount Annan, AU	52
Canberra, AU	47
Museo Entomologico de Leonlocation not on record	19
Adelaide, AU	9
Armidale, AU	8
James Cook Townsvillelocation not on record	7
NSW Dept of Planning, Industry and Environmentlocation not on record	6
Smithfield, AU	3
Kew, GB	2
EL PASO, US	1
Xiamen, CN	1
MAlocation not on record	1
IPA/SPlocation not on record	1
NSW Office of Environment and Heritagelocation not on record	1
Hobart, AU	1
John T. Waterhouse Herbariumlocation not on record	1
AUAlocation not on record	1
Palmerston, AU	1

19 institutions · 289 of 292 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Dampiera adpressa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)