Damasonium californicum

Torr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Alismataceae/Damasonium

At a glance

Occurrence records478

Data sources7

Biological traits91

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Damasonium californicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility478 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources91 traits

Occurrence & distributionGBIF478 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Damasonium californicum (лат.) — многолетнее травянистое растение; вид рода Звездоплодник (Damasonium) семейства Частуховые (Alismataceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.46 m

Seed mass1.22 mg

Seed mass max1.21 mg

Seed mass min1.21 mg

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodMid Spring

Coppice potentialNo

Flower colourwhite

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formhydroperennial

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsYes

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticaquatic

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourbrown

Growth formherb

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min8 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry18

Anaerobic toleranceHigh

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceNone

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min120 days

Moisture useHigh

Nitrogen fixation levelNone

Precipitation max18 in

Precipitation min12 in

Salinity toleranceNone

Shade toleranceHigh

Soil pH max7.8 pH

Soil pH min5.8 pH

Temperature min-23 °F

Uses & economy13

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound360 000 per lb

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max4 800 per acre

Planting density min2 700 per acre

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Damasonium californicum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF963800.1 ↗798 bpUSA

ACGT

TGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCTATCGCTTCATATGTTGAACCTGTAAATGTGACGTGTGT …

Damasonium californicum isolate CBP018 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type478 records

Wild obs. + sensor187

Museum / vouchered291

Origin

Native12

Range

Area of Occupancy AOO1 152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 107≤1 km 10≤10 km 7>10 km 11

135 georeferenced · 52 without coordinates

Open the mapobservation + sensor187

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 9≤1 km 74≤10 km 108>10 km 7

198 georeferenced · 93 without coordinates

Open the institutions mapphysical evidence291

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	41
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	28
Logan, US	21
Pullman, US	18
Claremont, US	15
CASlocation not on record	14
Moscow, US	11
Arcata, US	7
Davis, US	7
WTUlocation not on record	7
Santa Barbara, US	7
Canadian Department of Agriculturelocation not on record	7
Caldwell, US	5
San Diego, US	5
Henderson, US	4
Riverside, US	4
Pocatello, US	3
Flagstaff, US	2
Turku, FI	2
Ashland, US	2
Northridge, US	2
Provo, US	2
Bloomington, US	2
MAlocation not on record	1
San Luis Obispo, US	1
Chongqing Museumlocation not on record	1
Bronx, US	1
University of Stellenboschlocation not on record	1
TUR-Alocation not on record	1
ASUlocation not on record	1
Long Beach, US	1

31 institutions · 224 of 291 vouchered records shown · 67 without an institution code

09Environmental DNA2 detections

Where the DNA of Damasonium californicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)