Dalea pinnata

(J.F.Gmel.) Barneby · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalea

At a glance

Occurrence records585

Data sources8

Biological traits9

DNA specimens1

eDNA detections0

Sources8 archives

Databases and archives Dalea pinnata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility585 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF585 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Dalea pinnata est une espèce de plantes à fleurs de la famille des Fabaceae. Cette espèce est originaire du sud de la Floride. C'est une plante vivace qui pousse principalement dans le biome subtropical.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalea pinnata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627427.1 ↗561 bp

ACGT

ACAGAGACTAAAGCAAGTGTTGGGTTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACT …

Dalea pinnata voucher FLAS:Whitten 3982 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dalea pinnata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — WEIMARCK, G. 1970. Apomixis and sexuality and Hierochloe alpina (Gramineae) from Finland and Greenland and in ~ monticola from Greenland. Bot. Notiser 123: 495-504.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type585 records

Wild obs. + sensor476

Museum / vouchered109

Range

Area of Occupancy AOO1 428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 233≤1 km 59≤10 km 31>10 km 57

380 georeferenced · 96 without coordinates

Open the mapobservation + sensor476

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 4≤1 km 18≤10 km 21>10 km 31

74 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	30
Chapel Hill, US	19
Jackson, US	11
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Columbia, US	6
Chongqing Museumlocation not on record	6
AUAlocation not on record	6
Bloomington, US	6
Tall Timbers Research Stationlocation not on record	4
Valdosta State Universitylocation not on record	3
GAlocation not on record	2
Tuscaloosa, US	1
Wuzhou, CN	1
Florida Museum of Natural Historylocation not on record	1
Tampa, US	1
LDlocation not on record	1
Clemson, US	1
Bangkok, TH	1
Canadian Department of Agriculturelocation not on record	1

19 institutions · 108 of 109 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)