Dalea albiflora

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalea

At a glance

Occurrence records670

Data sources11

Biological traits13

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Dalea albiflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility670 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF670 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Dalea albiflora, the whiteflower prairie clover or scruffy prairie clover, is a perennial subshrub or herb of the subfamily Faboideae in the pea family-(Fabaceae). It is found in the southwestern United States and Northwestern Mexico in the states of Arizona, New Mexico, Sonora, and Chihuahua. Whiteflower prairie clover is a low-lying subshrub with horizontal spreading gray-green pinnate leaves. The flowers are vertical with multiple inflorescences; both flowers and leaves are extremely oily and resinous, and leave perfume-like odors on any surface: hands, boots, etc.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.45 mg

⚠ sources differ — TRY: 1.45 mg · GIFT: 1.53 mg

Seed mass max1.8 mg

Seed mass min1.2 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessvariable

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalea albiflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKEU025885.1 ↗1 530 bp

ACGT

ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCATTTATTTTTCAGGAGTATATTTATGGA …

Dalea albiflora maturase-like protein (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dalea albiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 72×CCDB · ipcn-api-dl · CCDB · Cannon, 2015

CCDB · ipcn-api-dl — Ward, D. E., R. Spellenberg & D. Sutherland. 1993. Chromosome numbers for Dalea species (Fabaceae) from southwestern New Mexico and southeastern Arizona. Phytologia 75(2): 166–169.

CCDB · Cannon, 2015 — Ward, D. E., R. Spellenberg & D. Sutherland, 1993

n 141×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type670 records

Wild obs. + sensor212

Museum / vouchered458

Origin

Native14

Range

Area of Occupancy AOO1 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 107≤1 km 25≤10 km 4>10 km 4

140 georeferenced · 72 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 28≤1 km 30≤10 km 60>10 km 20

138 georeferenced · 320 without coordinates

Open the institutions mapphysical evidence458

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	117
Flagstaff, US	51
Bronx, US	50
Phoenix, US	46
Riverside, US	34
Albuquerque, US	33
Mexico City, MX	16
Claremont, US	16
Austin, US	12
EL PASO, US	9
USFSlocation not on record	8
Saint Louis, US	8
Wuzhou, CN	6
San Diego, US	6
Ann Arbor, US	6
CASlocation not on record	5
Austin, US	4
DOI/NPS, Colonial National Historical Parklocation not on record	3
San Angelo, US	3
Angwin, US	2
Jena Microbial Resource Collectionlocation not on record	2
University of Stellenboschlocation not on record	2
Durango, MX	2
Durango, US	2
South Kensington, GB	2
WTUlocation not on record	1
US	1
Logan, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
San Francisco, US	1
Hermosillo, MX	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record	1
University of Alberta Museumslocation not on record	1
San Luis Obispo, US	1
Bloomington, US	1
Santa Barbara, US	1
Chapingo, MX	1

38 institutions · 458 of 458 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Dalea albiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)