Dalbergia tonkinensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records7

Data sources8

Biological traits7

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Dalbergia tonkinensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Dalbergia tonkinensis (or sua) is a species of legume in the family Fabaceae. It is a small tree, 5 - tall, found in Hainan Island of China and Vietnam. It is threatened by habitat loss and overexploitation for timber. Furniture made from sua wood is particularly prized in China. While commercial sales of sua are banned in Vietnam, private sales and auctions are still permitted. Individual trees have sold for over a million US dollars.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Raunkiær life formphanerophyte

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia tonkinensis has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR047525.1 ↗676 bpViet Nam

ACGT

GATTATAAATTGAATTATTATACTCCTGACTATGAAACGAAAGATACTGATATCTTGGCCGCATTCCGAGTAACTCCTCAACCTGGAGTT …

Dalbergia tonkinensis isolate Y22 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcL10ITS

plant barcodefungal barcode

08Occurrence & distribution

Record type7 records

Museum / vouchered7

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	1
Guangzhou, CN	1

2 institutions · 2 of 7 vouchered records shown · 5 without an institution code

09Environmental DNA9 detections

Where the DNA of Dalbergia tonkinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.