Dalbergia rimosa

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records390

Data sources10

Biological traits13

DNA specimens6

eDNA detections5

Sources10 archives

Databases and archives Dalbergia rimosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF390 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Dalbergia rimosa is a species of liana (or treelet), with the Vietnamese name trắc giây or trắc dây. The synonym Dalbergia discolor, with the Vietnamese name trắc biến màu, is no longer recognised.POWO: Dalbergia discolor Blume ex Miq. is a synonym of Dalbergia rimosa Roxb. The genus Dalbergia is placed in the subfamily Faboideae and tribe Dalbergieae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Deciduousnessdeciduous

Life formscrambling shrub or tree

Life spanperennial

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max900 m

Elevation min100 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density620 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia rimosa has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW523596.1 ↗494 bp

ACGT

TTATAAATTGAATTATTATACTCCTGACTATGAAACGAAAGATACTGATATCTTGGCCGCATTCCGAGTAACTCCTCAACCTGGAGTTCC …

Dalbergia rimosa voucher DL201 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dalbergia rimosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · Cannon, 2015

CCDB · Cannon, 2015 — Sanjappa, M. & A. Dasgupta., 1981

08Occurrence & distribution

Record type390 records

Museum / vouchered390

Range

Area of Occupancy AOO680 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 387 without coordinates

Open the institutions mapphysical evidence390

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	67
Kunming, CN	60
Guangzhou, CN	57
Edinburgh, GB	30
Guilin, CN	23
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	17
South Kensington, GB	11
Chengdu, CN	10
Cambridge, US	9
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	8
Xiamen, CN	6
Kew, GB	3
Guangzhou, CN	2
Yangling, CN	2
Bronx, US	2
Herbarium of South China Botanical Gardenlocation not on record	1
Wuhan, CN	1
LDlocation not on record	1
Nanjing, CN	1
Guangxi Agricultural Universitylocation not on record	1

20 institutions · 312 of 390 vouchered records shown · 77 without an institution code

09Environmental DNA5 detections

Where the DNA of Dalbergia rimosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)