Dalbergia pervillei — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records131

Data sources8

Biological traits19

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Dalbergia pervillei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionNPASS4 compounds

Occurrence & distributionGBIF131 records

DNA & barcodingNCBIsequences

01Narrative

Dalbergia pervillei is a species of legume in the family Fabaceae. It is found only in Madagascar. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height12 m

Seed mass117 mg

Seed mass max248 mg

Seed mass min32.5 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Dispersal typewind

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Dalbergia pervillei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Isoflavones2

Cinnamoyl phenols1

Documented compounds4 total

Compound	Amount	Source
Daidzein	present	NPASS
Epoxydon	present	NPASS
Genistein	present	NPASS
Obtustyrene	present	NPASS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia pervillei has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON226925.1 ↗339 bpMadagascar

ACGT

TTATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCAC …

Dalbergia pervillei voucher PMBL RIR3434 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL3ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type131 records

Wild obs. + sensor50

Museum / vouchered81

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 16

16 georeferenced · 34 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 81 records without

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	54
Kew, GB	15
MeiseBGlocation not on record	2
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1
Bronx, US	1
Stockholm, SE	1
South Kensington, GB	1
University of Stellenboschlocation not on record	1

8 institutions · 76 of 81 vouchered records shown · 5 without an institution code