Dalbergia peltieri — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records70

Data sources7

Biological traits16

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Dalbergia peltieri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF70 records

DNA & barcodingNCBIsequences

01Narrative

Dalbergia peltieri is a species of legume in the family Fabaceae. It is found only in Madagascar. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height7 m

Seed mass13.63 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia peltieri has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR159758.1 ↗310 bpMadagascar · 2019

ACGT

ATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGCCTGCC …

Dalbergia peltieri voucher RIR3477 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type70 records

Wild obs. + sensor7

Museum / vouchered63

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 63 records without

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	48
Kew, GB	6
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	3
MeiseBGlocation not on record	3
Stockholm, SE	1

5 institutions · 61 of 63 vouchered records shown · 2 without an institution code