Dalbergia parviflora

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records92

Data sources10

Biological traits8

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Dalbergia parviflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility92 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS113 compounds

Occurrence & distributionGBIF92 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dalbergia parviflora is a species of liana found in South East Asia. Its name is in Malay and Indonesian, in Thai, and in Vietnamese it is (i.e. "small flowers" as in the scientific name). The heartwood of the plant is lakawood, an aromatic wood used for incense. The genus Dalbergia is placed in the subfamily Faboideae and tribe Dalbergieae; no subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height25 m

Life cycle & reproduction1

Life formliana or shrub

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnitrogen_fixer

03Chemical composition113 compounds

Compounds documented for Dalbergia parviflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavanones53

Isoflavones43

Cinnamoyl phenols15

Flavanones11

Pterocarpan7

Documented compounds113 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Eriodictyol	present	LOTUS
(+)-Vestitol	present	LOTUS
(-)-Alpinetin	present	LOTUS
(-)-Mucronulatol	present	LOTUS
(-)-vestitol	present	LOTUS
(1R,12R)-16-methoxy-5,7,11,19-tetraoxapentacyclo[10.8.0.02,10.04,8.013,18]icosa-2,4(8),9,13(18),14,16-hexaen-17-ol	present	LOTUS
(2R,3R)-3,6-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-pinocembrin	present	LOTUS
(2S,3S)-3,5,7-trihydroxy-2-phenyl-2,3-dihydrochromen-4-one	present	LOTUS
(3R)-5'-Methoxyvestitol	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia parviflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAB828653.1 ↗641 bp

ACGT

AAGGATCATTGTCGATGCCTCAATCCAGAGAGACCCGCGGACACGTTTCAACTCCCGGGAAAGACGAAGCTGCCCAGCAGCTCGCCTTCC …

Dalbergia parviflora genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, partial and complete sequence, specimen_voucher: L:811

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type92 records

Museum / vouchered92

Range

Area of Occupancy AOO308 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤100 m 2≤10 km 15>10 km 13

30 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence92

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	27
Edinburgh, GB	5
South Kensington, GB	3
Xiamen, CN	2
Saint Louis, US	2
Paris, FR	1
Cambridge, US	1
H. Balslevlocation not on record	1

8 institutions · 42 of 92 vouchered records shown · 50 without an institution code

09Environmental DNA1 detections

Where the DNA of Dalbergia parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)