Dalbergia madagascariensis

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records49

Data sources9

Biological traits15

DNA specimens20

eDNA detections6

Sources9 archives

Databases and archives Dalbergia madagascariensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI20 specimens

01Narrative

Dalbergia madagascariensis is a species of legume in the family Fabaceae. It is found only in Madagascar. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height12 m

Life cycle & reproduction5

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia madagascariensis has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences6

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR159741.1 ↗311 bpMadagascar · 2019

ACGT

ATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGCCTGCC …

Dalbergia madagascariensis voucher RNH1209 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLtrnL-FITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor2

Museum / vouchered47

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	13
MeiseBGlocation not on record	12
Paris, FR	8
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	3
CJBGlocation not on record	3
Stockholm, SE	1
South Kensington, GB	1

7 institutions · 41 of 47 vouchered records shown · 6 without an institution code

09Environmental DNA6 detections

Where the DNA of Dalbergia madagascariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.