Dalbergia latifolia

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records337

Data sources14

Biological traits22

DNA specimens8

eDNA detections8

Sources14 archives

Databases and archives Dalbergia latifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF337 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · GoaT1.5 Gbp

01Narrative

Dalbergia latifolia, en français Palissandre de l'Inde, est une espèce d'arbres de la famille des légumineuses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology4

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 22.5 m

Seed mass44.09 mg

⚠ sources differ — TRY: 44.09 mg · GIFT: 41.47 mg

Seed mass max57.1 mg

Seed mass min25.84 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density734 mg/cm³

03Chemical composition27 compounds

Compounds documented for Dalbergia latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Open-chained neoflavonoids6

Norsesterterpenoids4

Rotenoids3

Prenyl quinone meroterpenoids3

Stigmastane steroids1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Furospongin 1	present	NPASS
(1S,6S,13S)-13-hydroxy-16,17-dimethoxy-6-[3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-1-en-2-yl]-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),9,14,16,18-hexaen-12-one	present	LOTUS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(R)-(+)-4-Methoxydalbergione	present	LOTUS
(S)-4-Methoxydalbergione	present	LOTUS
2-[(1S,2S)-1-[5-[(1R)-1-(2-hydroxyphenyl)prop-2-enyl]-2,4-dimethoxyphenoxy]-1-phenylpropan-2-yl]-5-methoxycyclohexa-2,5-diene-1,4-dione	present	LOTUS
2-[(2E,6E,10E,14E,18E)-3,7,11,15,19,23-hexamethyltetracosa-2,6,10,14,18,22-hexaenyl]benzene-1,4-diol	present	NPASS
2-[(2E,6E,10E,14E,18E,22E)-3,7,11,15,19,23,27-heptamethyloctacosa-2,6,10,14,18,22,26-heptaenyl]benzene-1,4-diol	present	NPASS
2-[1-[5-[1-(2-Hydroxyphenyl)prop-2-enyl]-2,4-dimethoxyphenoxy]-1-phenylpropan-2-yl]-5-methoxycyclohexa-2,5-diene-1,4-dione	present	LOTUS
2-Octaprenylhydroquinone	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia latifolia has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ337193.1 ↗490 bpIndia · 2018

ACGT

TCAACCTGGAGTTCCTCCTGAAGAAGCGGGTGCAGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACCGTTTGGACCGATGGGCT …

Dalbergia latifolia voucher AGV016 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dalbergia latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 474 335 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dalbergia latifolia1.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 207×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · book-indian_vol1 — Atchison, E. 1951 ; Mehra, P.N. & Hans, A.S. 1971, 1972; Mehra, P.N. 1972

CCDB · book-atlas-flowering-plants — India

CCDB · kew — Hiremath SC, Nagasampige MH. (pers. comm. 2001).

n 106×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — Sanjappa, M. & A. Dasgupta. 1981. In Chromosome number reports LXXI. Taxon 30: 508–509.

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn72 — MEHRA, P.N. 1972. Cytogenetical evolution of hardwoods. Nucleus 15: 64-83.

CCDB · book-ipcn72 — MEHRA, P.N., & A.S. HANS. 1971. Cytological observations on arborescent Leguminosae of eastern Himalayas. Nucleus 14: 144-152.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type337 records

Wild obs. + sensor218

Museum / vouchered117

Other2

Origin

Introduced3

Range

Area of Occupancy AOO916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 77≤1 km 13≤10 km 3>10 km 111

204 georeferenced · 14 without coordinates

Open the mapobservation + sensor218

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 5≤1 km 1≤10 km 5>10 km 5

16 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence117

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	19
Museo Entomologico de Leonlocation not on record	9
Edinburgh, GB	8
Tampa, US	6
Herbarium of the Department of Botany, University of Tokyolocation not on record	5
Bronx, US	3
Brisbane, AU	3
Taipei, TW	2
BISHlocation not on record	2
Honolulu, US	2
Pondicherry, IN	2
MeiseBGlocation not on record	2
Dehra Dun, IN	2
Nishihara, JP	1
Kensington, AU	1
TAFORI-LSRClocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Smithfield, AU	1

20 institutions · 72 of 117 vouchered records shown · 45 without an institution code

09Environmental DNA8 detections

Where the DNA of Dalbergia latifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.4 °C 28.4–28.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)34.1 °C

Min temp (night)22.5 °C

Precipitation46.0 mm/mo

Air humidity53.5 %

Moisture balance-109 mm/mo

Vapour deficit1,788 Pa

Wind speed2.30 m/s

Cloud cover4.50 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)