Dalbergia lanceolaria

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records501

Data sources13

Biological traits14

DNA specimens16

eDNA detections19

Sources13 archives

Databases and archives Dalbergia lanceolaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility501 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS73 compounds

Occurrence & distributionGBIF501 records

Environmental DNA2 datasets · 3 countries19 detections

DNA & barcodingBOLD · NCBI16 specimens

Genome at a glanceCCDB · GoaT1.4 Gbp

01Narrative

Dalbergia lanceolaria là một loài thực vật có hoa trong họ Đậu. Loài này được L.f. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height22 m

Seed mass22.0 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry5

Leaf n30.58 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)24.84 mm²/mg

Wood density561 mg/cm³

03Chemical composition73 compounds

Compounds documented for Dalbergia lanceolaria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones14

Isoflavones9

Rotenoids5

Simple phenolic acids4

Monomeric stilbenes3

Documented compounds73 total

Tissue Source Quantified only

Compound	Amount	Source
(10S)-10-[(9R)-4,5-dihydroxy-2-methyl-10-oxo-9H-anthracen-9-yl]-1,3,8-trihydroxy-6-methyl-10H-anthracen-9-one	present	NPASS
(3S,5S,8R,9S,10S,13R,14S,17R)-17-[(E,2R,5R)-5-ethyl-6-methylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(6R)-16,17-dimethoxy-6-[2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropan-2-yl]-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-1(13),3(11),4(8),9,14,16,18-heptaen-12-one	present	LOTUS
(6R)-16,17-dimethoxy-6-[2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropan-2-yl]-2,7,21-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-1(13),3(11),4(8),9,14,16,18-heptaen-12-one	present	LOTUS
(6S)-6-(2-hydroxypropan-2-yl)-16,17-dimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-1(13),3(11),4(8),9,14,16,18-heptaen-12-one	present	LOTUS
1,2,6-Tri-O-Galloyl-Beta-D-Glucose	present	NPASS
1,6-di-O-Galloylglucose	present	NPASS
1-[1-hydroxy-3-methyl-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxynaphthalen-2-yl]ethanone	present	NPASS
3,4-dihydroxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[(3,4,5-trihydroxybenzoyl)oxymethyl]oxan-2-yl]oxybenzoic acid	present	NPASS
5,7-Dihydroxy-3-(4-hydroxy-3-methoxyphenyl)-8-(3,4,5-trihydroxy-6-methoxyoxan-2-yl)chromen-4-one	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia lanceolaria has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes5

GenBank sequences10

eDNA detections19

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJX856440.1 ↗729 bp

ACGT

TCCCCTACTCACATTTTAGAGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCCCGATCAAG …

Dalbergia lanceolaria isolate 60 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL8★trnL-F★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dalbergia lanceolaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 427 880 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dalbergia lanceolaria1.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2011×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · book-fedorov — Atchison 1951

CCDB · book-atlas-flowering-plants

n 1010×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Sinha, S. S. & P. Kumar. 1978. Meiotic analysis in four lac host plants. J. Cytol. Genet. 13: 82–86.

CCDB · ipcn-api-dl — Sanjappa, M. & A. Dasgupta. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1975. In IOPB chromosome number reports XLIX. Taxon 24: 501–516.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn75-78 — Sanjappa & Dasgupta 1977

CCDB · book-ipcn75-78 — Bir & Kumari 1975

CCDB · book-ipcn73-74 — SARKAR, A.K., R. DATTA, & M. RAYCHOWDHURY. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type501 records

Wild obs. + sensor418

Museum / vouchered82

Other1

Range

Area of Occupancy AOO512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy70% within 1 km

≤100 m 7≤1 km 7≤10 km 2>10 km 4

20 georeferenced · 398 without coordinates

Open the mapobservation + sensor418

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 3≤10 km 10>10 km 2

15 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	18
Baroda, IN	9
Xiamen, CN	8
Edinburgh, GB	4
Kew, GB	2
Saint Louis, US	2
MSB-3349location not on record	2
Berlin, DE	1
H. Balslevlocation not on record	1
TAFORI-LSRClocation not on record	1
Cincinnati, US	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Fort Worth, US	1

14 institutions · 52 of 82 vouchered records shown · 29 without an institution code

09Environmental DNA19 detections

Where the DNA of Dalbergia lanceolaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 15.5–28.2

Seasonal swing summer↔winter18.7 °C

Max temp (day)19.9 °C 19.9–32.3

Min temp (night)11.1 °C 11.1–23.8

Precipitation99.0 mm/mo 82.2–159

Air humidity61.4 % 59.1–61.8

Moisture balance3.30 mm/mo -32.5–22.1

Vapour deficit679 Pa 679–1,548

Wind speed2.20 m/s 2.20–2.30

Cloud cover35.1 % 28.6–44.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)