Dalbergia cearensis

Ducke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records389

Data sources12

Biological traits16

DNA specimens7

eDNA detections3

Sources12 archives

Databases and archives Dalbergia cearensis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF389 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Dalbergia cearensis, radial and cross section Dalbergia cearensis, with common names Brazilian kingwood, kingwood, Bois de Violette, and violetwood, is a small tree endemic to Brazil. It is native to the states of Bahia, Ceará, Paraíba, Pernambuco, and Piauí,Legume Web: Dalbergia cearensis It is the source of kingwood, a classic furniture wood.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height10 m

Plant height max8 m

Life cycle & reproduction3

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCaatinga (stricto sensu), Carrasco, Floresta Estacional Decidual, Floresta Estacional Semidecidual

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density883 mg/cm³

03Chemical composition10 compounds

Compounds documented for Dalbergia cearensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavanones3

Isoflavones2

Neoflavonoids2

Acyl phloroglucinols1

Open-chained neoflavonoids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-Mucronulatol	present	LOTUS
(S)-4-Methoxydalbergione	present	LOTUS
(±)-3',7-Dihydroxy-2',4'-dimethoxyisoflavan	present	LOTUS
2,5-Dihydroxy-4-methoxybenzophenone	present	LOTUS
3'-O-Methylviolanone	present	LOTUS
Dalbergin	present	LOTUS
Formononetin	present	LOTUS
GWOKWCRSUJQOMD-QMCAAQAGSA-N	present	NPASS
HKQYGTCOTHHOMP-OPOMHRLSSA-N	present	NPASS
ZRWJIZYZTLTXJI-UHFFFAOYSA-N	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia cearensis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB828663.1 ↗669 bp

ACGT

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTCAAATCCAGAGAGACCCGCGGACACGTTCGAATGCCCGG …

Dalbergia cearensis genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, partial and complete sequence, specimen_voucher: MO:1775

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★trnL-F★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dalbergia cearensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · book-ipcn73-74 · CCDB · iapt

CCDB · book-ipcn73-74 — BANDEL, G. 1974. Chromosome numbers and evolution in the Leguminosae Caryologia 27: 17-32.

CCDB · iapt — IAPT/IOPB Chromosome Data 20

08Occurrence & distribution

Record type389 records

Wild obs. + sensor61

Museum / vouchered328

Origin

Native184

Range

Area of Occupancy AOO892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 59 without coordinates

Open the mapobservation + sensor61

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 328 records without

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 51 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	57
UNIVASFlocation not on record	28
Université de Bordeauxlocation not on record	27
Salvador, BR	23
Universidade Federal do Vale do São Franciscolocation not on record	18
UFBAlocation not on record	17
Bronx, US	16
JBRJlocation not on record	16
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	12
Kew, GB	10
UFRPElocation not on record	9
Feira de Santana, BR	8
USP-IBlocation not on record	7
UFPElocation not on record	6
Universidade Federal do Ceara, Departamento de Biologialocation not on record	6
CPATSAlocation not on record	6
CEPLAClocation not on record	4
Chaguaramas, TT	4
Universidade Federal do Rio Grande do Nortelocation not on record	4
Universidade Federal do Maranhãolocation not on record	4
Ilhéus, BR	3
Cruz das Almas, BR	3
Cenargenlocation not on record	3
Fortaleza, BR	3
UnBlocation not on record	3
UNICAPlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Brasília, BR	2
UFERSAlocation not on record	2
Paris, FR	1
Universidade Federal do Espírito Santolocation not on record	1
Saint Louis, US	1
Universidade Federal de Sergipe (UFS)location not on record	1
UFPIlocation not on record	1
HACAMlocation not on record	1
Museu Paraense Emílio Goeldilocation not on record	1
UNESP-IBILCElocation not on record	1
UFPRlocation not on record	1
University of Stellenboschlocation not on record	1
Porto Alegre, BR	1
UFSClocation not on record	1
Brasília, BR	1
Museum of Zoologylocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
PUC-RIOlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
Edinburgh, GB	1
Cuiabá, BR	1
UFVJMlocation not on record	1
Masindi, UG	1
Royal Botanic Gardens, Kewlocation not on record	1

51 institutions · 328 of 328 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Dalbergia cearensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.8–24.8

Seasonal swing summer↔winter2.20 °C

Max temp (day)31.4 °C

Min temp (night)19.5 °C

Precipitation3.10 mm/mo

Air humidity52.4 %

Moisture balance-113 mm/mo

Vapour deficit1,488 Pa

Wind speed1.60 m/s

Cloud cover19.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)