Dalbergia assamica

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dalbergia

At a glance

Occurrence records197

Data sources11

Biological traits14

DNA specimens17

eDNA detections12

Sources11 archives

Databases and archives Dalbergia assamica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility197 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF197 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Dalbergia balansae also known as Dalbergia assamica is a species of legume in the family Fabaceae. It is found in China and Vietnam. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 15 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment6

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min900 m

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density525 mg/cm³

⚠ sources differ — TRY: 525 mg/cm³ · GIFT: 632 mg/cm³

03Chemical composition19 compounds

Compounds documented for Dalbergia assamica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavones6

Pterocarpan4

Flavan-3-ols2

Isoflavanones2

Rotenoids1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Rhododendrol	present	NPASS
(+)-Vestitol	present	NPASS
(-)-3-Hydroxy-9-methoxypterocarpan	present	LOTUS
(-)-Catechol	present	NPASS
4-(4-Hydroxyphenyl)-2-butanone	present	NPASS
6''-Acetylononin	present	NPASS
6-Hydroxy-7,2'-dimethoxy-4',5'-methylenedioxyisoflavone	present	LOTUS
8-Hydroxydaidzein	present	NPASS
9-ethoxy-6a,11a-dihydro-6H-[1]benzofuro[3,2-c]chromen-3-ol	present	LOTUS
Afromosin	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dalbergia assamica has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes3

GenBank sequences7

eDNA detections12

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ144643.1 ↗155 816 bp

ACGT

ATATATATATTGATATATATATAGTGGTTTTTTTTTAATTGCGATCTCTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCAC …

Dalbergia assamica voucher RS91 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dalbergia assamica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants · CCDB · kew

CCDB · book-indian_vol1 — Mehra, P.N. & Hans, A.S. 1969, 1971, 1972

CCDB · book-atlas-flowering-plants — India

CCDB · kew — Hiremath SC, Nagasampige MH. (pers. comm. 2001).

n 104×CCDB · book-ipcn72 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn72 — MEHRA, P.N., & A.S. HANS. 1971. Cytological observations on arborescent Leguminosae of eastern Himalayas. Nucleus 14: 144-152.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

08Occurrence & distribution

Record type197 records

Wild obs. + sensor11

Museum / vouchered186

Range

Area of Occupancy AOO408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 3

7 georeferenced · 4 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 5

5 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence186

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	57
Kunming, CN	54
Edinburgh, GB	13
Cambridge, US	7
Guilin, CN	6
Kew, GB	5
Guangzhou, CN	5
South Kensington, GB	5
Bronx, US	3
Xiamen, CN	3
Herbarium of South China Botanical Gardenlocation not on record	3
nlocation not on record	3
Laboratorio de Ictiologialocation not on record	2
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	2
UFESlocation not on record	1
Taipei, TW	1
Berlin, DE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
JBRJlocation not on record	1
Guiyang, CN	1
Guizhou Forestry Schoollocation not on record	1

21 institutions · 175 of 186 vouchered records shown · 11 without an institution code

09Environmental DNA12 detections

Where the DNA of Dalbergia assamica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.7–25.1

Seasonal swing summer↔winter21.8 °C

Max temp (day)28.0 °C 27.6–28.4

Min temp (night)20.8 °C 20.4–21.1

Precipitation237 mm/mo 233–241

Air humidity65.7 % 64.3–67.0

Moisture balance99.1 mm/mo 87.4–111

Vapour deficit1,085 Pa 1,030–1,139

Wind speed2.70 m/s 1.90–3.50

Cloud cover46.2 % 42.7–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)