Dais cotinifolia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Thymelaeaceae/Dais

At a glance

Occurrence records968

Data sources8

Biological traits23

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Dais cotinifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility968 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF968 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Dais cotinifolia, known as the pompom tree, is a small Southern African tree belonging to the Thymelaeaceae family. It occurs along the east coast northwards from the Eastern Cape, inland along the Drakensberg escarpment through KwaZulu-Natal and the Transvaal, with an isolated population in the Eastern Highlands of Zimbabwe. It flowers profusely during the summer months and produces a multitude of pink, sweet-scented, globular flowerheads about 10 cm across. Depending on the circumstances it can reach a height of up to 12m, although it rarely exceeds 6m in cultivation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height5 m

Plant height max12.18 m

Plant height min1.37 m

Seed mass9.18 mg

Seed mass max9.18 mg

Seed mass min9.18 mg

Life cycle & reproduction5

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 830 m

Elevation min15 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dais cotinifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ744928.1 ↗665 bpSouth Africa

ACGT

GGATCATTGTCGAATCCTGCATAGCAGAACAACCCGTGAACTTATACACACAACGTGTCAAGTTGGACTGGTGCCATTTGGCTCTATTCC …

Dais cotinifolia ITS1, 5.8S rRNA gene and ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type968 records

Wild obs. + sensor759

Museum / vouchered209

Origin

Native192

Range

Area of Occupancy AOO2 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 531≤1 km 84≤10 km 13>10 km 13

641 georeferenced · 118 without coordinates

Open the mapobservation + sensor759

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 4≤1 km 3≤10 km 2>10 km 1

10 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	108
Durban, ZA	31
Auckland, NZ	10
TAFORI-LSRClocation not on record	7
Saint Louis, US	6
Cape Town, ZA	4
Kew, GB	4
Canadian Department of Agriculturelocation not on record	4
Tampa, US	4
Bronx, US	3
Rotorua, NZ	3
Riverside, US	2
MeiseBGlocation not on record	2
Christchurch, NZ	2
University of Stellenboschlocation not on record	2
South African National Biodiversity Institutelocation not on record	1
Berlin, DE	1
Philadelphia, US	1
MSB-3054location not on record	1
Chongqing Museumlocation not on record	1
GRAlocation not on record	1
Chicago, US	1
San Diego, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Glocation not on record	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1

26 institutions · 203 of 209 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Dais cotinifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 16.0–18.5

Seasonal swing summer↔winter13.2 °C

Max temp (day)23.9 °C 21.7–26.1

Min temp (night)10.8 °C 10.1–11.5

Precipitation36.1 mm/mo 34.8–37.5

Air humidity51.6 % 48.9–54.3

Moisture balance-77.4 mm/mo -94.4–-60.4

Vapour deficit995 Pa 842–1,147

Wind speed2.40 m/s 2.00–2.80

Cloud cover15.6 % 15.2–16.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)