Dahlia tenuicaulis

P.D.Sørensen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Dahlia

At a glance

Occurrence records196

Data sources10

Biological traits7

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Dahlia tenuicaulis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF196 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Dahlia tenuicaulis est une espèce de plantes à fleurs de la famille des Asteraceae originaire des montagnes du sud du Mexique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formtuberous geophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition15 compounds

Compounds documented for Dahlia tenuicaulis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Chalcones8

Flavanones4

Flavandiols (Leucoanthocyanidins)2

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-5,7-dimethoxy-2-(4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2R)-5-hydroxy-7-methoxy-2-(4-methoxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2R,4S)-5,7-dimethoxy-2-(4-methoxyphenyl)-3,4-dihydro-2H-chromen-4-ol	present	LOTUS
(2S,4S)-5,7-dimethoxy-2-(4-methoxyphenyl)-3,4-dihydro-2H-chromen-4-ol	present	LOTUS
(S)-5,7-Dimethoxy-2-(4-methoxyphenyl)chroman-4-one	present	LOTUS
1-(2,4-Dihydroxyphenyl)-3-(3-hydroxy-4-methoxyphenyl)prop-2-en-1-one	present	LOTUS
1-(2,4-Dihydroxyphenyl)-3-(4-Hydroxyphenyl)Prop-2-En-1-One	present	LOTUS
2-Propen-1-one, 1-(2-hydroxy-4-methoxyphenyl)-3-(4-hydroxyphenyl)-	present	LOTUS
3,2',4'-Trihydroxy-4-methoxychalcone	present	LOTUS
ethanolamine	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dahlia tenuicaulis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF165840.1 ↗635 bp

ACGT

TCGAAACCTGCATGGCAGAACAACCCGTGAACAAGTAAAAACATCCGGCTTGACACGAACCGAAACTTATGTTTTGGGTCGTGTGAAGTC …

Dahlia tenuicaulis internal transcribed spacer 1, 5.8S ribosomal RNA, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dahlia tenuicaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 324×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Gatt, M., H. Ding, K. Hammett & B. Murray. 1998. Polyploidy and evolution in wild and cultivated Dahlia species. Ann. Bot. (Oxford) 81: 647–656.

CCDB · ipcn-api-dl — Gatt, M., K. Hammett & B. Murray. 2000. Interspecific hybridization and the analysis of meiotic chromosome pairing in Dahlia (Asteraceae--Heliantheae) species with x = 16. Pl. Syst. Evol. 221: 25–33.

CCDB · ipcn-api-dl — Gatt, M. K., K. R. W. Hammett & B. G. Murray. 2000. Molecular phylogeny of the genus Dahlia Cav. (Asteraceae, Heliantheae--Coreopsidinae) using sequences derived from the internal transcribed spacers of nuclear ribosomal DNA. Bot. J. Linn. Soc. 133(2): 229–239.

CCDB · kew — Temsch EM, Greilhuber J, Hammett KRW, Murray BG. 2008. Genome size in Dahlia Cav. (Asteraceae-Coreopsideae). Plant Systematics and Evolution 276: 157-166.

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hansen, H. V. & J. P. Hjerting. 1996. Observations on chromosome numbers and biosystematics in Dahlia (Asteraceae, Heliantheae) with an account on the identity of D. pinnata, D. rosea, and D. coccinea. Nordic J. Bot. 16(4): 445–455.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type196 records

Wild obs. + sensor20

Museum / vouchered155

Cultivated / captive1

Other20

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 3≤1 km 4≤10 km 4

11 georeferenced · 9 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 80≤1 km 8≤10 km 7>10 km 12

107 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence155

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	40
Mexico City, MX	28
Durango, MX	19
Dekalb, US	18
Bronx, US	6
Mexico City, MX	5
Austin, US	5
Ciudad de México, MX	4
University of Stellenboschlocation not on record	4
Christchurch, NZ	4
Auckland, NZ	4
Wellington, NZ	2
Guasave, MX	2
Paris, FR	1
Kew, GB	1
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	1
Riverside, US	1
Tampa, US	1
Giardini Botanici Hanburylocation not on record	1
Ciudad de México, MX	1
Madison, US	1
Autlán de Navarro, MX	1
Burlington, US	1
Edinburgh, GB	1
Saint Louis, US	1
ASUlocation not on record	1

26 institutions · 154 of 155 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dahlia tenuicaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)