Dactylorhiza aristata

(Fisch. ex Lindl.) Soó · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dactylorhiza

At a glance

Occurrence records1 175

Data sources10

Biological traits15

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Dactylorhiza aristata's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF1 175 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 42

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.4 m

Plant height min0.2 m

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dactylorhiza aristata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC554302.1 ↗427 bpJapan · 2016

ACGT

TCTTGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACGTGGTGCGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCA …

Dactylorhiza aristata M16-31 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL2★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dactylorhiza aristata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidydiploid inferred

Chromosome records40–422n range42median42mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Yokota, M. 1987. Karyotypes and phylogeny in Orchidinae and allied subtribes. Pp. 70--79 in. In Proc. 12th World Orchid Conference 1987. 12th World Orchid Conference Organizing Committee, Tokyo.

CCDB · ipcn-api-dl — Yokota, M. 1990. Karyomorphological studies on Habenaria, Orchidaceae, and allied genera from Japan. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 23: 53–161.

CCDB · book-ipcn67-71 — LOEVE, A., & w. SIMON. 1968. Cytotaxonomical notes on some American orchids. southw. Naturalist 13: 335-342.

2n 401×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Miduno 1939

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type1 175 records

Wild obs. + sensor783

Museum / vouchered392

Range

Area of Occupancy AOO3 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 351≤1 km 99≤10 km 75>10 km 125

650 georeferenced · 133 without coordinates

Open the mapobservation + sensor783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 2≤1 km 13≤10 km 76>10 km 12

103 georeferenced · 289 without coordinates

Open the institutions mapphysical evidence392

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Shinshu Universitylocation not on record	58
Moscow State Universitylocation not on record	46
Toyama, JP	34
Tsukuba, JP	26
KIRMlocation not on record	26
Bronx, US	22
Institute of the biological problems of the North FEB RASlocation not on record	21
Nagano City, JP	15
Otaru, JP	15
Madison, US	14
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	13
Kushiro City Museumlocation not on record	12
Chicago, US	12
Anchorage, US	8
Tomioka, JP	6
JP	6
Omachi Alpine Museumlocation not on record	6
Nishihara, JP	6
J.F.Oberlin Universitylocation not on record	5
Sendai, JP	5
Fukushima Universitylocation not on record	4
Hokkaido University Botanic Gardenlocation not on record	4
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	4
Iwate Prefectural Museumlocation not on record	3
WTUlocation not on record	2
Saint Louis, US	2
Chongqing Museumlocation not on record	2
Cambridge, US	2
SIHUlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Provincia di Livornolocation not on record	1
Hokkaido University Museumlocation not on record	1
Pullman, US	1
Cambridge, US	1
Provo, US	1
Nishihara, JP	1
Harvard Universitylocation not on record	1
Vancouver, CA	1

38 institutions · 390 of 392 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Dactylorhiza aristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dactylorhiza aristata

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 175 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 175 records