Dactylopius opuntiae

(Cockerell, 1896) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Dactylopiidae/Dactylopius

At a glance

Occurrence records1 081

Data sources8

Biological traits0

DNA specimens178

eDNA detections178

Sources8 archives

Databases and archives Dactylopius opuntiae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 081 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI178 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics178 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 081 records

Environmental DNA1 datasets · 3 countries178 detections

DNA & barcodingBOLD178 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Dactylopius opuntiae Cockerell, 1929, è un insetto dell'ordine dei Rincoti Omotteri. Originario dell'America centrale è un fitofago associato alle cactacee del genere Opuntia, fra le quali il fico d'India. Contrariamente alla congenere Dactylopius coccus, la cocciniglia del carminio, D. opuntiae dà una limitata produzione del pigmento perciò al momento ha uno scarso interesse sotto questo aspetto. Gli ambiti di studio su questa cocciniglia riguardano in particolare gli aspetti biologici ai fini del miglioramento genetico delle cocciniglie del carminio. La specie è stata in passato impiegata per il controllo biologico delle Opuntia infestanti in Australia e, con scarso successo, in Sudafrica. In Messico rappresenta uno degli agenti di danno a carico delle coltivazioni di fico d'India.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding178 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dactylopius opuntiae has left across the world's sequence archives.

At a glance

DNA specimens178

BINs1

Marker genes3

eDNA detections178

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P602 bp consensus118 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 48 variable positions, in barcode order

1Gmostly conserved

2Cmostly conserved

3Tmostly conserved

4Cmostly conserved

5Tmostly conserved

6Cmostly conserved

8Gmostly conserved

12Amostly conserved

16Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Cmostly conserved

20Gmostly conserved

22Amostly conserved

23Cmostly conserved

25Gmostly conserved

26Amostly conserved

30Amostly conserved

32Tmostly conserved

33Tmostly conserved

35Amostly conserved

36Cmostly conserved

38Cmostly conserved

39Amostly conserved

43Amostly conserved

47Amostly conserved

49Tmostly conserved

50Tmostly conserved

51Tmostly conserved

55Amostly conserved

57Cmostly conserved

70Amostly conserved

133Amostly conserved

183Cmostly conserved

189Gmostly conserved

210Cvariable

249Gvariable

318Tmostly conserved

324Tmostly conserved

357Amostly conserved

375Avariable

384Tmostly conserved

396Amostly conserved

536Amostly conserved

537Tvariable

540Tvariable

563Avariable

595Cmostly conserved

GCTCTCAGAATAATTATTCGAACAGAAATAATTAACACAAATAATTATTTTAACAACCAATTCTATTATATAACCATTACCACACACGCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes13

BIN1

Most divergent pair2.2%

OtherN.AmericaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dactylopius confusussame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Dactylopius opuntiae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 102×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Gavrilov, I. (2007). A catalog of chromosome numbers and genetic systems of scale insects (Homoptera: Coccinea) of the world. Isr. J. Entomol, 37, 1-45. ↗

08Occurrence & distribution

Record type1 081 records

Wild obs. + sensor1 068

Museum / vouchered13

Origin

Native251

Range

Area of Occupancy AOO2 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 384≤1 km 278≤10 km 66>10 km 16

744 georeferenced · 324 without coordinates

Open the mapobservation + sensor1 068

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Agricultural Research Council, Plant Protection Research Institute, South Africalocation not on record	1
Universidad Nacional Autónoma de Méxicolocation not on record	1

2 institutions · 2 of 13 vouchered records shown · 11 without an institution code

09Environmental DNA178 detections

Where the DNA of Dactylopius opuntiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found178

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 178 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.6 °C 17.4–22.3

Seasonal swing summer↔winter10.8 °C

Max temp (day)26.8 °C 23.7–27.5

Min temp (night)13.7 °C 12.1–16.8

Precipitation74.2 mm/mo 43.2–103

Air humidity51.4 % 51.4–57.8

Moisture balance-64.3 mm/mo -78.6–-35.5

Vapour deficit1,177 Pa 841–1,201

Wind speed2.00 m/s 1.60–3.90

Cloud cover16.3 % 15.6–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dactylopius opuntiae

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 081 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 081 records