Dactyloctenium aegyptium
(L.) Willd. · speciesAt a glance
Occurrence records19 161
Data sources12
Biological traits57
DNA specimens51
eDNA detections31
Sources12 archives
Databases and archives Dactyloctenium aegyptium's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility19 161 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics51 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources57 traits
Occurrence & distributionGBIF19 161 records
Environmental DNA1 datasets · 7 countries31 detections
DNA & barcodingBOLD · NCBI51 specimens
Genome at a glanceCCDB · GIFT1.9 Gbp
01Narrative
Dactyloctenium aegyptium, or Egyptian crowfoot grass is a member of the family Poaceae native in Africa. The plant mostly grows in heavy soils at damp sites.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length1 mm
Fruit length max1.14 mm
Fruit length min0.85 mm
Fruit width0.865 mm
Fruit width max1.03 mm
Fruit width min0.7 mm
Leaf length140 mm
Leaf length max250 mm
Leaf length min30 mm
Leaf size420 mm²
Leaf width5 mm
Leaf width max7.5 mm
Leaf width min2.5 mm
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · AusTraits: 0.55 m · TRY: 0.85 m
Plant height max1 m
Plant height min0 m
Seed mass0.292 mg
⚠ sources differ — TRY: 0.292 mg · AusTraits: 0.327 mg · GIFT: 0.244 mg
Seed mass max0.47 mg
Seed mass min0.13 mg
Seed volume0.23 mm³
Seed volume max0.23 mm³
Seed volume min0.23 mm³
Life cycle & reproduction11
Dispersal typeanimal
Flowering endMay
Flowering startApr
Flowering timeyynnnnnnnnny
Life formannual or perennial
Life spanannual short_lived_perennial
⚠ sources differ — AusTraits: annual short_lived_perennial · GIFT: annual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry5
Leaf n24.6 mg/g
Leaf p2.24 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Specific leaf area (SLA)8.93 mm²/mg
Other traits4
Fruit height0.525 mm
Fruit height max0.55 mm
Fruit height min0.55 mm
Shoot orientationascending
05DNA & barcoding51 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dactyloctenium aegyptium has left across the world's sequence archives.
At a glance
DNA specimens51
Marker genes8
GenBank sequences10
eDNA detections31
Countries7
The DNA barcodea real sequence read deposited for this species
CATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTCCTGACCGAGGGCACGTCTGCCTGGGCGTCACGCCAGAGTACAACTCCCCACCC …
Dactyloctenium aegyptium voucher F63 (UQU) 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★trnL★trnL-F★ITS8★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Dactyloctenium aegyptium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 858 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Dactyloctenium aegyptium1.86 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy2× diploid · measured
Chromosome records18–522n range38median48mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 488×CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 · CCDB · book-fedorov +3
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Parodi, L.R. 1946 ; . Gupta, P.K. 1963b, 1971 ; Larsen, K. 1963b ; Christo- pher, J. & Abraham, A. 1974 ; Dujardin, M. 1978
CCDB · book-fedorov — An,IlYJIOD 1928
CCDB · book-fedorov — Parodi 1946
CCDB · book-fedorov — Larsen 1963b
CCDB · book-atlas-flowering-plants — Avdulov 1931, E.K.J.*Fo
CCDB · Cave1963 — Larsen 1963b
GIFT · GIFT (floras)
2n 346×CCDB · book-indian_vol2 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Krisbnaswamy, N. 1931 (Chandola, R.P. 1959)
CCDB · book-indian_vol2 — Krishnaswamy, N. & Ayyangar, R. 1935a
CCDB · book-fedorov — Krishnaswamy 1931
CCDB · book-fedorov — Krishnaswamy, .
CCDB · book-fedorov — Ayyangar 1935a
GIFT · GIFT (floras)
2n 365×CCDB · book-indian_vol2 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Moffett, A.A. & Hurcombe, R. 1949 ; Chandola, R.P. 1959; Gould, F.W. 1966; Muniyamma, M. & Narayan, K.N. 1971 ; Mehra, P.N. & Sharma, M.L. I975d .
CCDB · book-fedorov — Moffett, Hurcombe 1949
CCDB · book-fedorov — Chandola 1959
CCDB · book-fedorov — Gould 1966
GIFT · GIFT (floras)
2n 404×CCDB · book-ipcn65 · CCDB · book-indian_vol2 · CCDB · book-fedorov +1
CCDB · book-ipcn65 — Tateoka 1965c
CCDB · book-indian_vol2 — Tateoka, T. 1965a; Gupta, P.K. & Yasbvir, 1971 ; Mehra, P.N. & Sharma, M.L. 1975f; Sharma, M.L. & Sharma, K. 1978
CCDB · book-fedorov — Tateoka 1965a
GIFT · GIFT (floras)
2n 203×CCDB · book-indian_vol2 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Gould, F.W. 1960
CCDB · book-fedorov — Gould 1960
GIFT · GIFT (floras)
2n 443×CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.
CCDB · book-indian_vol2 — Gould, F.W. & Soderstrom, T.R. 1974
GIFT · GIFT (floras)
2n 182×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Baquar, S.R. & Saeed, M. 1969
GIFT · GIFT (floras)
2n 222×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Bir, S.S., Gill, B.S. & Kanta, S. 1980
GIFT · GIFT (floras)
2n 382×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Olorode, O. 1974b
GIFT · GIFT (floras)
2n 462×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Mehra, P.N. & Chaudhary, J.D. 1974
GIFT · GIFT (floras)
2n 421×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bhattacharyya, B. 1973. Chromosome analysis of some Indian members of the tribe Eragrosteae. J. Cytol. Genet. 7–8: 161–164.
2n 521×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 207×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Bir, S. S. & C. Singh. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 60–61.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2002. Chromosome studies on African plants. 18. The subfamily Chloridoideae. Bothalia 32(2): 240–249.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An analysis of polyploidy. Taxon 52(4): 736–746.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. I. Basic chromosome numbers. Taxon 52(3): 557–566.
CCDB · book-ipcn67-71 — GUPTA, P.K . & YASHVIR. 1971. In IOPB chromosome reports XXXII. Taxon 20: 349-356.
CCDB · book-ipcn75-78 — Sharma & Sharma 1978
CCDB · book-ipcn75-78 — Mehra & Sharma 1975e
n 237×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Bir, S. S., B. S. Gill & S. Kanta. 1980a. In Chromosome number reports LXIX. Taxon 29: 710–7ll.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · book-ipcn75-78 — Kalia 1978
CCDB · book-ipcn73-74 — MEHRA, P.N., & J.D. CHAUDHARY. 1974. In IOPB chromosome number reporl XLVI. Taxon 23: 801-812.
GIFT · GIFT (floras)
n 243×CCDB · book-ipcn72 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74
CCDB · book-ipcn72 — GUPTA, P.K. 1971. Cytological investigations in some North Indian grasses. Genet. Iber. 23: 183-198.
CCDB · book-ipcn75-78 — Dujardin 1978
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
n 92×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BAQUAR, S.R . & M. SAEED. 1969. Chromosome ~tudies and polyploidy analysis in grasses of West Pakistan I. Caryologia 22: 103-111.
CCDB · book-ipcn67-71 — BAQUAR, s.R., & M. SAEED. 1969. Chromosome studies and polyploidy analysis in grasses of West Pakistan. I. Caryologia 22: 103-111.
n 262×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma, C. B., B. N. Behera & S. K. Dash. 1978. A cytological study of some grasses from Orissa, an eastern coastal belt of India. Proc. Indian Acad. Sci. 87B 11: 355–360.
CCDB · ipcn-api-dl — SHARMA, M. L. & A. Salam. 1980. In Chromosome number reports LXIX. Taxon 29: 706.
n 111×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sachdeva, S. K. & R. Kals. 1981. Cytologic, morphologic and chemotaxonomic studies in Dactyloctenium aegyptium (L.) Beauv. complex. Proc. Indian Acad. Sci., B 90: 59–69.
n 181×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Mehra & Sharma 1975c
n 191×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — OLORODE, o. 1974. Chromosome counts in some Nigerian grasses. Cytologia 39: 429-435.
n 211×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bhattacharyya, B. 1973. Chromosome analysis of some Indian members of the tribe Eragrosteae. J. Cytol. Genet. 7–8: 161–164.
n 271×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type19 161 records
Wild obs. + sensor13 261
Museum / vouchered5 786
Cultivated / captive19
Other95
Origin
Native9
Introduced563
Range
Area of Occupancy AOO43 004 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 3 977≤1 km 702≤10 km 976>10 km 357
6 012 georeferenced · 7 249 without coordinates
Open the mapobservation + sensor13 261
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 830≤1 km 251≤10 km 548>10 km 149
1 778 georeferenced · 4 008 without coordinates
Open the institutions mapphysical evidence5 786
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 19 records without
Open the mapnot free-living19
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions180 of 371 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 423 |
| Durango, MX | 286 |
| Brisbane, AU | 235 |
| Pretoria, ZA | 220 |
| University of Stellenboschlocation not on record | 161 |
| Bronx, US | 128 |
| Kew, GB | 127 |
| MeiseBGlocation not on record | 123 |
| Tampa, US | 120 |
| Palmerston, AU | 116 |
| Austin, US | 93 |
| Canberra, AU | 93 |
| National Biodiversity Institute, Costa Ricalocation not on record | 74 |
| San Diego, US | 74 |
| Mérida, MX | 73 |
| LaCarto/IGATE/UAClocation not on record | 65 |
| UNIVASFlocation not on record | 64 |
| Xiamen, CN | 63 |
| KMCClocation not on record | 59 |
| Ann Arbor, US | 55 |
| Beijing, CN | 52 |
| Jena Microbial Resource Collectionlocation not on record | 51 |
| La Paz, MX | 48 |
| Guangzhou, CN | 46 |
| Mount Annan, AU | 44 |
| Mexico City, MX | 43 |
| Paris, FR | 43 |
| Baroda, IN | 42 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 40 |
| Laboratorio de Ictiologialocation not on record | 36 |
| Masindi, UG | 35 |
| Riverside, US | 35 |
| Miami, US | 34 |
| Museo Entomologico de Leonlocation not on record | 32 |
| Mexico City, MX | 32 |
| Kunming, CN | 31 |
| San Isidro, AR | 30 |
| UFERSAlocation not on record | 30 |
| Smithfield, AU | 29 |
| Aarhus, DK | 29 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 29 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 25 |
| Antiguo Cuscatlán, SV | 24 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 24 |
| ASUlocation not on record | 24 |
| Salvador, BR | 24 |
| IBANNlocation not on record | 24 |
| Université de Bordeauxlocation not on record | 23 |
| Taipei, TW | 23 |
| LSF/FSA/UAClocation not on record | 22 |
| UFMSlocation not on record | 21 |
| St. Augustine, TT | 21 |
| Auckland, NZ | 20 |
| Altos de Pipe, VE | 20 |
| Zapopan, MX | 20 |
| Universidade Federal do Maranhãolocation not on record | 19 |
| Honolulu, US | 19 |
| Kensington, AU | 19 |
| QAUlocation not on record | 19 |
| Guasave, MX | 18 |
| Odawara, JP | 18 |
| Universidade Federal de Sergipe (UFS)location not on record | 18 |
| Feira de Santana, BR | 18 |
| Bangkok, TH | 18 |
| JBRJlocation not on record | 18 |
| Culiacán, MX | 18 |
| Montecillo, Texcoco, MX | 17 |
| Mérida, MX | 17 |
| Departamento de Sistematica e Ecologialocation not on record | 16 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 16 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 16 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 15 |
| Fort Worth, US | 15 |
| Cenargenlocation not on record | 15 |
| UFRPElocation not on record | 15 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 15 |
| WAGlocation not on record | 15 |
| US | 15 |
| Bloomington, US | 15 |
| Plocation not on record | 15 |
| UFBAlocation not on record | 15 |
| Valdosta State Universitylocation not on record | 14 |
| UFESlocation not on record | 14 |
| València, ES | 14 |
| BIO-UNIPIlocation not on record | 14 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 14 |
| Canadian Department of Agriculturelocation not on record | 14 |
| BISHlocation not on record | 13 |
| San José, CR | 13 |
| Ciudad de México, MX | 13 |
| Torreón, MX | 13 |
| EL PASO, US | 13 |
| Guilin, CN | 13 |
| Tapachula, MX | 13 |
| Brasília, BR | 13 |
| Federal University of Espírito Santolocation not on record | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 13 |
| Chengdu, CN | 12 |
| Jackson, US | 12 |
| Moscow State Universitylocation not on record | 12 |
| Kathmandu, NP | 12 |
| Ciudad de México, MX | 12 |
| Brasília, BR | 12 |
| Guangzhou, CN | 12 |
| Berlin, DE | 11 |
| Fortaleza, BR | 11 |
| UFPElocation not on record | 11 |
| Yaoundé, CM | 11 |
| LDlocation not on record | 11 |
| Chapingo, MX | 11 |
| Claremont, US | 11 |
| Philadelphia, US | 10 |
| GZUlocation not on record | 10 |
| Wuzhou, CN | 10 |
| San Francisco de Campeche, MX | 10 |
| James Cook Townsvillelocation not on record | 10 |
| Chongqing Museumlocation not on record | 10 |
| Phoenix, US | 10 |
| Stockholm, SE | 10 |
| León, NI | 9 |
| LEA/FSA/UAClocation not on record | 9 |
| MEXUlocation not on record | 9 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 8 |
| CASlocation not on record | 8 |
| Bern, CH | 8 |
| Columbia, US | 8 |
| Hobart, AU | 8 |
| MAlocation not on record | 8 |
| BDBClocation not on record | 8 |
| Chaguaramas, TT | 7 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 7 |
| CEPLAClocation not on record | 7 |
| Hermosillo, MX | 7 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 7 |
| BMlocation not on record | 7 |
| Christchurch, NZ | 7 |
| BClocation not on record | 7 |
| UnBlocation not on record | 7 |
| Flagstaff, US | 7 |
| GAlocation not on record | 7 |
| HNBlocation not on record | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 7 |
| Davis, US | 7 |
| Uppsala, SE | 7 |
| Parthenon Tama History Museumlocation not on record | 7 |
| Autlán de Navarro, MX | 7 |
| Tuscaloosa, US | 7 |
| Adelaide, AU | 7 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| BAYLUlocation not on record | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Juriquilla, MX | 6 |
| Tlalnepantla, MX | 6 |
| Austin, US | 6 |
| Instituto de Investigação Científica Tropicallocation not on record | 6 |
| CJBGlocation not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| California Academy of Scienceslocation not on record | 6 |
| Ensenada, MX | 6 |
| Cape Town, ZA | 6 |
| Los Angeles, US | 5 |
| Yunnan Universitylocation not on record | 5 |
| Zacatecas, MX | 5 |
| Wlocation not on record | 5 |
| Conservatoire Botanique National de Mascarinlocation not on record | 5 |
| Logan, US | 5 |
| University of Southern Mississippilocation not on record | 5 |
| TAFORI-LSRClocation not on record | 5 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 5 |
| AUAlocation not on record | 5 |
| Córdoba, AR | 5 |
| University of Hargeisalocation not on record | 5 |
| Dekalb, US | 5 |
| Durban, ZA | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Santa Barbara, US | 4 |
| Dresden, DE | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| South Kensington, GB | 4 |
| College Park, US | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| IPA/SPlocation not on record | 4 |
| Chapel Hill, US | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| GMBAlocation not on record | 4 |
| Castelar, AR | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| LSFlocation not on record | 4 |
| Armidale, AU | 4 |
| Universidad Nacional Federico Villarreallocation not on record | 4 |
| Chicago, US | 4 |
| Mazatlán, MX | 4 |
| UNICAMPlocation not on record | 3 |
| Santa Teresa, BR | 3 |
| Calabar, NG | 3 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 3 |
| Guatemala City, GT | 3 |
| EFGlocation not on record | 3 |
| Herbier National du Gabonlocation not on record | 3 |
| Cruz das Almas, BR | 3 |
| Mexico City, MX | 3 |
| Sangmiung Universitylocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Edinburgh, GB | 3 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Lubbock, US | 3 |
| Universidade Federal do Espírito Santolocation not on record | 3 |
| Chadron, US | 3 |
| Zürich, CH | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Arcata, US | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Appalachian State Universitylocation not on record | 2 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Campo Mourão, BR | 2 |
| EAlocation not on record | 2 |
| Morelia, MX | 2 |
| Hazara Universitylocation not on record | 2 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 2 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 2 |
| Loja, EC | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Pittsburg, US | 2 |
| Hangzhou, CN | 2 |
| MCNAMlocation not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| Clemson, US | 2 |
| LISClocation not on record | 2 |
| Quito, EC | 2 |
| San Jose, US | 2 |
| UEMAlocation not on record | 2 |
| Arusha, TZ | 2 |
| Cambridge, US | 2 |
| Burlington, US | 2 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| DanBIFlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| INMAlocation not on record | 2 |
| Coimbra, PT | 2 |
| HACAMlocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| Ilhéus, BR | 2 |
| Long Beach, US | 2 |
| DSMlocation not on record | 2 |
| Addis Ababa, ET | 2 |
| Vancouver, CA | 2 |
| Changsha, CN | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Granada, ES | 2 |
| LBVlocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Ivano-Frankivsk, UA | 2 |
| Montpellier, FR | 2 |
| Cape Town, ZA | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Maringá, BR | 1 |
| USP-IBlocation not on record | 1 |
| Norfolk, US | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Alicante, ES | 1 |
| Barcelona, ES | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Sucre, BO | 1 |
| Corrientes, AR | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Northridge, US | 1 |
| IFAN Cheikh Anta DIOPlocation not on record | 1 |
| Seoul, KR | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Clocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| IECOSlocation not on record | 1 |
| Xining, CN | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Universität Tübingenlocation not on record | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Vitoria, ES | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Provo, US | 1 |
| WTUlocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| Bogotá, D.C., CO | 1 |
| Irvine, US | 1 |
| Salta, AR | 1 |
| LGlocation not on record | 1 |
| UIBlocation not on record | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| CUVClocation not on record | 1 |
| Lanzhou, CN | 1 |
| GJOlocation not on record | 1 |
| Taipei, TW | 1 |
| La Paz, BO | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| Glocation not on record | 1 |
| BRLUlocation not on record | 1 |
| Pullman, US | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Chicago, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Pamplona, ES | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Sanda, JP | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Millersville, US | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| OTSlocation not on record | 1 |
| LNBG$location not on record | 1 |
| UFRRJlocation not on record | 1 |
| Little Rock, US | 1 |
| University of Johannesburglocation not on record | 1 |
| HAWlocation not on record | 1 |
| Santarém, BR | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| South African National Parks, Scientific Services, Kruger National Parklocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Whitehorse, CA | 1 |
| Puebla, MX | 1 |
| Madison, US | 1 |
| UFPIlocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Asheville, US | 1 |
| Seropédica, BR | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Davenport, US | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Williamsburg, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Boise, US | 1 |
| Cuiabá, BR | 1 |
| Oskarshamn, SE | 1 |
| Due West, US | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Brussel, BE | 1 |
| Santa Cruz, US | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| UEPAlocation not on record | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| Texas A&M Universitylocation not on record | 1 |
| ESALQlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Madrid, ES | 1 |
| University of New Hampshirelocation not on record | 1 |
| Helsinki, FI | 1 |
371 institutions · 5 363 of 5 786 vouchered records shown · 421 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Dactyloctenium aegyptium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map7 countries0
Grasslandred soil near riverUHURU North PlotsDisturbed areas around buildings.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.2 °C 15.7–26.8
Seasonal swing summer↔winter8.80 °C
Max temp (day)28.2 °C 22.0–31.4
Min temp (night)18.6 °C 11.7–23.0
Precipitation49.2 mm/mo 9.90–146
Air humidity57.0 % 50.9–60.4
Moisture balance-88.7 mm/mo -120–-11.9
Vapour deficit1,245 Pa 884–1,522
Wind speed2.60 m/s 2.00–4.10
Cloud cover36.0 % 12.3–64.5
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.