Dactylis glomerata
speciesAt a glance
Occurrence records1 436 509
Data sources14
Biological traits156
DNA specimens305
eDNA detections983
Sources14 archives
Databases and archives Dactylis glomerata's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 436 509 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI983 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics305 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources156 traits
Chemical compositionLOTUS12 compounds
Occurrence & distributionGBIF1 436 509 records
Environmental DNA3 datasets · 20 countries983 detections
DNA & barcodingBOLD · NCBI305 specimens
Genome at a glanceCCDB · GoaT · NCBI4.2 Gbp
01Narrative
Dactylis glomerata, also known as cock's-foot, orchard grass, or cat grass (due to its popularity for use with domestic cats) is a common species of grass in the genus Dactylis. It is a cool-season perennial C3 bunchgrass native throughout most of Europe, temperate Asia, and northern Africa.Flora Europaea: Dactylis glomerataInteractive Flora of NW Europe Dactylis glomerata (Cock's-foot)USDA Plant Fact Sheet: ORCHARDGRASSFAO factsheet: Dactylis glomerata
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology32
Fruit length5.7 mm
Fruit length max6.5 mm
Fruit length min4.9 mm
Fruit width1 mm
Fruit width max1.1 mm
Fruit width min0.9 mm
Inflorescence length max15 cm
Inflorescence length min0.8 cm
Leaf length500 mm
Leaf length max350 mm
Leaf length min2 mm
Leaf mass71.71 mg
Leaf size2 245 mm²
⚠ sources differ — TRY: 2 245 mm² · LEDA: 1 703 mm² · GIFT: 1 449 mm²
Leaf width8 mm
⚠ sources differ — AusTraits: 8 mm · GIFT: 5 mm
Leaf width max14 mm
Leaf width min1 mm
Plant height0.705 m
⚠ sources differ — GIFT: 0.705 m · AusTraits: 1.4 m · LEDA: 0.454 m · USDA: 1.22 m · TRY: 0.416 m
Plant height generative0.867 m
Plant height max1.4 m
Plant height min0.2 m
Seed length2.78 mm
⚠ sources differ — TRY: 2.78 mm · GIFT: 1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.835 mg
⚠ sources differ — TRY: 0.835 mg · LEDA: 0.978 mg · GIFT: 0.919 mg
Seed mass max1.29 mg
Seed mass min0.39 mg
Seed volume1.2 mm³
Seed volume max1.2 mm³
Seed volume min1.2 mm³
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction38
After harvest regrowth rateRapid
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flower length max4 mm
Flowering endJul
Flowering startMay
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed number69 459
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation mean2 836 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min135 days
Leaf C:N ratio17.78 g/g
Leaf c448 mg/g
Leaf dry-matter content (LDMC)273 mg/g
Leaf n24.36 mg/g
Leaf p2.13 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min28 in
Protein potentialMedium
Salinity toleranceMedium
Seed longevity index0
Shade toleranceMedium
Soil pH max7.8 pH
Soil pH min5 pH
Specific leaf area (SLA)25.38 mm²/mg
Temperature min-33 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound427 200 per lb
ToxicityNone
Veneer productNo
Other traits11
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit height0.55 mm
Fruit height max0.6 mm
Fruit height min0.6 mm
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition12 compounds
Compounds documented for Dactylis glomerata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Cinnamic acids and derivatives9
Flavones3
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2R)-2-hydroxy-1-[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxypropane-1,2,3-tricarboxylic acid | present | LOTUS | |
| (1R,2S)-1-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-2-hydroxypropane-1,2,3-tricarboxylic acid | present | LOTUS | |
| (1R,2S)-1-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxypropane-1,2,3-tricarboxylic acid | present | LOTUS | |
| (2R,3R)-2-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-3-methoxycarbonylpentanedioic acid | present | LOTUS | |
| (2S,3R)-2-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-3,4-dihydroxybutanoic acid | present | LOTUS | |
| (2S,3S)-2-[(E)-3-(3,4-dihydroxyphenyl)prop-2-enoyl]oxy-3,4-dihydroxybutanoic acid | present | LOTUS | |
| Cryptochlorogenic acid | present | LOTUS | |
| Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside | present | LOTUS | |
| Neochlorogenic acid | present | LOTUS | |
| Orientin | present | LOTUS |
05DNA & barcoding305 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dactylis glomerata has left across the world's sequence archives.
At a glance
DNA specimens305
Marker genes14
GenBank sequences10
eDNA detections983
Countries20
The DNA barcodea real sequence read deposited for this species
GCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTTGGCCGAGGGCACGCCTGCCTGGGCGTCACGTAAAACACGCTTCCG …
Dactylis glomerata voucher PLT.0006 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Other
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS1★ITS2atpF-atpHcp-trnL-intronpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Dactylis glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 151 610 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Dactylis glomerata4.15 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× / 4× cytotypes
Chromosome records14–422n range28median28mode290records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 28198×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +20
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — EDWARDS Y. IN KIRSHNER J. & DRABKOVA L. - 1999. . IOPB , 31: 12.
CCDB · ita-fl — RYSER P. IN KIRSHNER J. & DRABKOVA L. - 1999. . IOPB , 31: 12.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · brit-fl — Borrill, M. J. Linn. Soc., Bot. 56: 441-452 (1961)
CCDB · brit-fl — Borrill, M., Carroll, C.P. Cytologia 34: 6-17 (1969)
CCDB · brit-fl — Jones, K., , Cytologia 26: 333-343 (1961)
CCDB · brit-fl — Bocher, T.W. Bot. Tidsskr. 56: 314-335 (1961)
CCDB · brit-fl — Beddows, A.R. J. Ecol. 47: 223-239 ()
CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)
CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 2 Queirs, M.Bol. Soc. Brot. ser. 248: 81-98(1974).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4497
CCDB · fl-europaea — L0ve & LBve, 1956
CCDB · poland — Doroszewska A. 1961. A comparative study on Dactylis slovenica Dom. and Dactylis glomerata L.\nActa Soc. Bot. Pol. 30, 775-802.
CCDB · poland — Doroszewska A. 1963. An investigation on the diploid and tetraploid forms of Dactylis glomerata\nL. ssp. Woronowii (Ovczin.) Stebbins and Zohary. Acta Soc. Bot. Pol. 32, 113-130.
CCDB · poland — Rurka T. Z. 1974. Distribution of diploid forms of Daclylis in Poland. Fragm. Flor. Geobot. 20, 471-476.
CCDB · poland — Mizianty M. 1991. Biosystematic studies on Dactylis L. (Poaceae). 2 Original research. 2. 2. Cytological differentiation of the genus in Poland. Fragm. Flor. Geobot. 36(2): 301-320.
CCDB · book-ipcn65 — Titz 1965
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — Schifino, M. T. & H. Winge. 1983. Karyotypes and nuclear DNA content of species of the Briza complex and some other genera of Poeae (Gramineae). Revista Brasil Gen;aaet. 6: 245–259.
CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.
CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1981. Chromosome studies in some Festuceae. J. Indian Bot. Soc. 60: 148–153.
CCDB · ipcn-api-dl — Sorokin, S. N. 1991. Chromosome numbers in the members of the family Poaceae from the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1331–1332.
CCDB · ipcn-api-dl — Fuchs, J., A. Brandes & I. Schubert. 1995. Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227–241.
CCDB · ipcn-api-dl — Baltisberger, M. & P. Ryser. 1999. IOPB chromosome data 15. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 31: 12.
CCDB · ipcn-api-dl — Greilhuber, J. & M. Baranyi. 1999. Feulgen densitometry: importance of a stringent hydrolysis regime. Pl. Biol. (Stuttgart) 1: 538–540.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · ipcn-api-dl — Seledets. 2005. Ecological area of species: karyological aspects. Pages 95--97 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
+129 more references
2n 1488×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +17
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — SPERANZA M., CRISTOFOLINI G. - 1987. The genus Dactylis L. in Italy. 2. The diploid entities.. Webbia , 41(2): 213-224.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt
CCDB · iber-fl — Karyotype Morphology of some diploid subspecie of Dactylis glomerata L. (Poaceae). Wetschnig, W.Phyton (Horn. Austria)31(1): 35-55(1991).
CCDB · iber-fl — Dactylis glomerata subsp. izcoi, a new subspecies from Galicia NW Iberian Peninsula. Ortiz, S. & J. Rodriguez-Oubia.Ann. Bot. Fenn.30: 305-311(1993).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4498
CCDB · fl-europaea — Lundqvist, 1965
CCDB · poland — Rurka T. Z. 1974. Distribution of diploid forms of Daclylis in Poland. Fragm. Flor. Geobot. 20, 471-476.
CCDB · poland — ?ukowski W. and S?owi?ska T. 1979. Chromosome numbers of Angiosperms of North-Western Poland. Part 1. Fragm. Flor. Geobot. 25, 477-483.
CCDB · poland — Doroszewska A. 1963. An investigation on the diploid and tetraploid forms of Dactylis glomerata\nL. ssp. Woronowii (Ovczin.) Stebbins and Zohary. Acta Soc. Bot. Pol. 32, 113-130.
CCDB · poland — Mizianty M. 1985. Banding patterns in plant chromosomes. III. Dactylis glomerata subsp. aschersoniana (Graebner) Thell. from Poland. Acta Soc. Bot. Pol. 54, 169-178.
CCDB · poland — Mizianty M. 1991. Biosystematic studies on Dactylis L. (Poaceae). 2 Original research. 2. 2. Cytological differentiation of the genus in Poland. Fragm. Flor. Geobot. 36(2): 301-320.
CCDB · mediterranean
CCDB · book-ipcn65 — Titz 1965
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1990. Cytological studies on some Kashmir grasses---V. Dactylis glomerata Linn. J. Cytol. Genet. 25: 74–77.
CCDB · ipcn-api-dl — Nazarova, E. & A. Goukasian. 1995. Mediterranean chromosome number reports 5 (528--542). Fl. Medit. 5: 340–345.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zheng, F. h. Xue, J. f. Yun, L. y. Wang & X. q. Fu. 1995. The chromosome numbers of 35 forage species and their geographical distribution. Grassl. China 1995(1): 16–20.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, F. h. Xue, L. y. Wang, J. f. Yun & X. q. Fu. 2000. The chromosome numbers and natural distribution of 38 forage plants in north China. Grassl. China 2000(5): 1–5.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Mizianty, M. 1985. Banding patterns in plant chromosomes. III. Dactylis glomerata subsp. aschersoniana (Graebner) Thell. from Poland. Acta Soc. Bot. Poloniae 54: 169–178.
CCDB · ipcn-api-dl — Speranza, M. & G. Cristofolini. 1987. The genus Dactylis L. in Italy. 2. The diploid entities. Webbia 41: 213–224.
CCDB · ipcn-api-dl — Wetschnig, W. 1983. Zur karyologie van Dactylis glomerata L. (Poaceae) am Súdost - Rand der Alpen. Phyton (Horn) 23: 271–305.
CCDB · ipcn-api-dl — Wetschnig, W. 1991. Karyotype morphology of some diploid subspecies of Dactylis glomerata L. (Poaceae). Phyton (Horn) 31: 35–55.
CCDB · ipcn-api-dl — Baltisberger, M. & P. Ryser. 1999. IOPB chromosome data 15. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 31: 12.
CCDB · ipcn-api-dl — Zukowski, W. & T. Slowinska. 1979. Chromosome numbers of angiosperms of Northwestern Poland. Fragm. Florist. Geobot. 25: 477–483.
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1979. Chromosome numbers of some grasses (Poaceae) in the U.S.S.R. flora. III. Bot. Zhurn. 64 (9): 1245–1258.
CCDB · ipcn-api-dl — Mizianty, M. 1991. Biosystematic studies on Dactylis (Poaceae). 2. Original research. 2.2. Cytological differentiation of the genus in Poland. Fragm. Florist. Geobot. 36: 301–320.
CCDB · ipcn-api-dl — Krahulcová, A. 1990. Selected chromosome counts of the Czechoslovak flora II. Folia Geobot. Phytotax. 25: 381–388.
CCDB · ipcn-api-dl — Wetschnig, W. 1984. Zur Morphologie, Karyologie und Verbreitung von Dactylis glomerata L. (Poaceae) in Kärnten. Carinthia II 174: 107–130.
CCDB · ipcn-api-dl — Cartier, D. & S. Blaise. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · ipcn-api-dl — Schönfelder, P. & D. Ludwig. 1996. Dactylis metlesicsii (Poaceae), eine neue Art der Gebirgsvegetation von Tenerife, Kanarische Inseln. Willdenowia 26: 217–223.
CCDB · ipcn-api-dl — Teppner, H. 2002. Poaceae in the greenhouses of the Botanic Garden of the Institute of Botany in Graz (Austria, Europe). Fritschiana 31: 1–42.
CCDB · book-ipcn67-71 — BORRILL, M., & R. LINDNER. 1971. Diploid - tetraploid sympatry in Dactylis (Gramineae). New Phytol. 70: 1111-1124.
CCDB · book-ipcn67-71 — BORRILL, M., & C.P. CARROLL. 1969. A chromosome atlas of the genus Dactyl is (Part Two). Cytologia 34: 6-17.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol2 — Stebbins, G.L. & Zohary, D. 1959; Borrill, M. 1961 ; Mehra, P.N. & Sharma, M.L. 1977a, b
CCDB · book-indian_vol2 — Mehra, P.N. & Sunder, S. 1969
+23 more references
2n 273×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Titz, W. (1964a). Vergleichende Untersuchungen über den Grad der somatischen Polyploidie an nahe vewandten diploiden und polyploiden Sippen einschlieBlich der Cytologie von Antipoden. Diss. Universität Wien pp. 124
CCDB · CromoCat 2015 — Titz, W. (1965). Vergleichende Untersuchungen über den Grad der somatischen Polyploidie an nahe verwandten diploiden un polyploiden Sippen einschlieBlich der Cytologie von Antipoden. Österr. Bot. Z. 112(1/2):101-172.
CCDB · CromoCat 2015 — Borrill, M. & Carroll, C. P. (1969). A chromosome atlas of the genus Dactylis (Part Two). Cytologia 34: 6-17.
2n 353×CCDB · poland · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · poland — Mizianty M. 1991. Biosystematic studies on Dactylis L. (Poaceae). 2 Original research. 2. 2. Cytological differentiation of the genus in Poland. Fragm. Flor. Geobot. 36(2): 301-320.
CCDB · ipcn-api-dl — Mizianty, M. 1991. Biosystematic studies on Dactylis (Poaceae). 2. Original research. 2.2. Cytological differentiation of the genus in Poland. Fragm. Florist. Geobot. 36: 301–320.
CCDB · CromoCat 2015 — Mizianty, M. (1991). Biosystematic studies on Dactylis (Poaceae). 2. Original Research. 2.2. Cytological differentiation of the genus in Poland. Fragm. Florist. Geobot. 36:301-320
2n 423×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol2 · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-indian_vol2 — Hansen, A.A. & Hill, H.D. 1953b ; Mehra, P.N. et al. 1968 lB Mehra, P.N. & Sunder, S. 1969
CCDB · kew — Horjales M, Redondo N, Pérez B, Brown S. 1995. Presencia en Galicia de Dactylis glomerata L. Hexaploide. Boletim da Sociedada Broteriana (Ser. 2) 67: 223-230.
2n 292×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Borrill, M. & Carroll, C. P. (1969). A chromosome atlas of the genus Dactylis (Part Two). Cytologia 34: 6-17.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, H, Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1789
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
2n 341×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Caroli, G. (1952). The effect of some oxyquinoline derivatives on pea chromosomes Agri Hort. Genet. 10: 152-157.
n 1422×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +3
CCDB · iber-fl — Contribucin al conocimiento cariolgico de la subfam. Pooideae (Poaceae) en el SW de Espaa. Devesa, J. A. & T. Luque.Bol. Soc. Brot. ser. 261: 281-304(1988).
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). III. Devesa, J. A. & al.Bol. Soc. Brot. ser. 264: 35-74(1991).
CCDB · ipcn-api-dl — Devesa, J. A. & T. Luque. 1988. Contribución al conocimiento cariológico de la subfam. Pooideae (Poaceae) en el SW de España. Bol. Soc. Brot., sér. 2 61: 281–304.
CCDB · ipcn-api-dl — De Montmollin, B. 1984. Etude cytotaxonomique de la flore de la Crète. II. Nombres chromosomiques. Bot. Helv. 94: 261–267.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Dalgaard, V. 1985. Chromosome studies in flowering plants from Madeira. Willdenowia 15: 137–156.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, M. C. Viera, R. Tormo, F. Vázquez, J. P. Carrasco, A. Ortega & J. Pastor. 1991. Contribución al conocimiento cariológico de las Poaceae en Extremadura (España)---III. Bol. Soc. Brot., sér. 2 64: 35–74.
CCDB · ipcn-api-dl — Ferchichi, A., M. A. Nabli & J. Delay. 1994. Prospection caryologique de la famille des Poaceae en Tunisie steppique. Acta Bot. Gallica 141(3): 327–341.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Borrill, M. & Lindner, R. (1971). Diploid-Tetraploid sympatry in Dactylis (Gramineae). New Phytol. 70: 1111-1124.
CCDB · CromoCat 2015 — Devesa, J. A. & Luque, T. (1988). Contribución al conocimiento cariológico de la subfam. Pooideae (Poaceae) en el SW de España. Bol. Soc. Brot. 61: 281-304.
CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · CromoCat 2015 — Montmollin, B. de. (1984). Étude cytotaxonomique de la flore de la Crète. II. Nombres chromosomiques. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 94: 261-267.
CCDB · CromoCat 2015 — Rancken, G. (1931). Eräiden nurmiheinälajien Kromosomeista. Tesis Helsinki
CCDB · CromoCat 2015 — Rancken, G. (1934). Zytologische Untersuchungen an einigen wirtschaftlich wertvollen Wiesengräsern. Acta Agr. Fennica 29: 1-94.
CCDB · CromoCat 2015 — Sorsa, V. (1962). Chromosomenzahlen Finnischer Kormophyten, I. Ann. Acad. Sci. Fenn., Sér. A 58: 1-14.
CCDB · CromoCat 2015 — Jones, K. Carroll, C.P. & M. Borrill (1961). A chromosome atlas of the genus Dactylis L. Cytologia 26(3-4): 333-343
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Devesa, J. A., Ruíz, T., Viera, M., Tormo, R., Vázquez, F., Carrasco, J., Ortega, A. & Pastor, J. (1991). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). III. Bol. Soc. Brot. 64: 35-74.
n 717×CCDB · iapt · CCDB · iber-fl · CCDB · ipcn-api-dl +3
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 276-283. Romero Zarco, C. & J. A. Devesa.Lagascalia12(1): 124-128(1983).
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 161–162.
CCDB · ipcn-api-dl — Spies, J. J., S. M. C. v. Wyk, I. C. Nieman & E. J. L. Liebenberg. 1997. Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The tribe Poeae. Bothalia 27: 75–82.
CCDB · ipcn-api-dl — Romero Zarco, C. & J. A. Devesa. 1983. Numeros 276-283, In: Numeros cromosomicos para la flora espanola 257-300. Lagascalia 12: 124–128.
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
CCDB · book-ipcn75-78 — Mehra & Sharma 1977a
CCDB · book-ipcn73-74 — HU, W.W-L., & D.H. TIMOTHY. 1971. Cytological studies of four diplol Dactylis subspecies, their hybrids and induced tetraploid hybrids. C1 Sci. (Madison) 11: 203-207. I
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1987). SOCGI plant chromosome number reports -- IV [i.e., V] J. Cytol. Genet. 22: 161-162
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · CromoCat 2015 — Spies, J.J., S.M.C. Van Wyk, I.C. Nieman & E.J.L. Liebenberg (1997). Cytogenetic studies in some representatives of the subfamily Pooideae (Poaceae) in South Africa. 3. The Tribe Poeae Bothalia 27:75-82
CCDB · CromoCat 2015 — Kaur, H, Gupta, R. C & Kumari, S. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1789
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Romero Zarco, C. & J. A. Devesa. (1983). Números cromosómicos para la flora española, 276-283. Lagascalia 12(1): 124-128.
CCDB · iapt — IAPT/IOPB Chromosome Data 29
CCDB · iapt — IAPT/IOPB Chromosome Data 33
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness97.7% BUSCO
07Deep time~9.56 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin9.56 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type1 436 509 records
Wild obs. + sensor1 392 075
Museum / vouchered31 363
Cultivated / captive7 295
Other5 776
Origin
Native59 256
Introduced22 895
Range
Area of Occupancy AOO983 356 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 298 990≤1 km 248 001≤10 km 588 383>10 km 7 598
1 142 972 georeferenced · 249 103 without coordinates
Open the mapobservation + sensor1 392 075
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 2 291≤1 km 5 718≤10 km 11 857>10 km 1 145
21 011 georeferenced · 10 352 without coordinates
Open the institutions mapphysical evidence31 363
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy48% within 1 km
≤100 m 2≤1 km 2 516≤10 km 2 643>10 km 73
5 234 georeferenced · 2 061 without coordinates
Open the mapnot free-living7 295
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions276 of 542 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 11 593 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 194 |
| Moscow State Universitylocation not on record | 543 |
| LDlocation not on record | 512 |
| Helsinki, FI | 506 |
| Berlin, DE | 390 |
| BFLlocation not on record | 353 |
| Chongqing Museumlocation not on record | 261 |
| Kew, GB | 254 |
| MeiseBGlocation not on record | 232 |
| Uppsala, SE | 232 |
| Tallinn, EE | 219 |
| Olocation not on record | 214 |
| Uniwersytet Warszawskilocation not on record | 214 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 212 |
| Philadelphia, US | 206 |
| Salzburg, AT | 205 |
| Beijing, CN | 204 |
| Wuzhou, CN | 198 |
| Bronx, US | 196 |
| Görlitz, DE | 196 |
| SLU Artdatabankenlocation not on record | 185 |
| Chengdu, CN | 162 |
| Odawara, JP | 154 |
| Bergen, NO | 148 |
| Oulu, FI | 146 |
| Saint Louis, US | 144 |
| Adam Mickiewicz University in Poznańlocation not on record | 140 |
| Christchurch, NZ | 137 |
| Tartu, EE | 135 |
| Oskarshamn, SE | 132 |
| WTUlocation not on record | 130 |
| CICYTEXlocation not on record | 124 |
| Victoria, CA | 123 |
| Karlsruhe, DE | 120 |
| MAlocation not on record | 119 |
| Trondheim, NO | 114 |
| Museo Entomologico de Leonlocation not on record | 114 |
| Denver, US | 107 |
| Shinshu Universitylocation not on record | 103 |
| Adelaide, AU | 102 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 98 |
| International Salmonella Centre (W.H.O.)location not on record | 95 |
| Claremont, US | 94 |
| Moscow, US | 94 |
| Nagano City, JP | 94 |
| Madison, US | 94 |
| Bloomington, US | 90 |
| Riverside, US | 89 |
| Canberra, AU | 88 |
| Auckland, NZ | 88 |
| Turku, FI | 87 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 86 |
| College Park, US | 86 |
| Angwin, US | 85 |
| Kuopio, FI | 84 |
| KMNlocation not on record | 84 |
| UniKSlocation not on record | 83 |
| Wlocation not on record | 82 |
| Mount Annan, AU | 81 |
| Chiba, JP | 81 |
| Spearfish, US | 78 |
| Pullman, US | 76 |
| Ann Arbor, US | 75 |
| TROMlocation not on record | 75 |
| Kunming, CN | 74 |
| Albuquerque, US | 72 |
| Hobart, AU | 71 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 71 |
| QAUlocation not on record | 69 |
| Flagstaff, US | 69 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 68 |
| ASUlocation not on record | 66 |
| Chengdu, CN | 65 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| Corvallis, US | 62 |
| Bern, CH | 61 |
| University of Stellenboschlocation not on record | 60 |
| Québec, CA | 60 |
| València, ES | 60 |
| Provincia di Livornolocation not on record | 59 |
| BDBClocation not on record | 58 |
| South Kensington, GB | 58 |
| Kochi, JP | 58 |
| College of the Atlantic, Museumlocation not on record | 58 |
| St. Paul, US | 57 |
| Vancouver, CA | 57 |
| Barcelona, ES | 57 |
| BRNUlocation not on record | 57 |
| DBF-NHMDlocation not on record | 56 |
| Córdoba, ES | 55 |
| SVN019location not on record | 55 |
| Burlington, US | 55 |
| Arcata, US | 53 |
| Fukushima Universitylocation not on record | 53 |
| Williamsburg, US | 52 |
| Davis, US | 51 |
| TUR-Alocation not on record | 50 |
| Jyväskylä, FI | 50 |
| CZE082location not on record | 50 |
| Santa Barbara, US | 49 |
| Toyama, JP | 48 |
| Bando, JP | 44 |
| Université Lavallocation not on record | 44 |
| Irkutsk State Universitylocation not on record | 44 |
| Logan, US | 44 |
| San Diego, US | 43 |
| Uniwersytet Opolskilocation not on record | 43 |
| Brisbane, AU | 43 |
| New Haven, US | 42 |
| Dresden, DE | 42 |
| Mlocation not on record | 41 |
| Acadia Universitylocation not on record | 41 |
| Pretoria, ZA | 39 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 38 |
| DOI/NPS, Greenbelt Parklocation not on record | 38 |
| Missoula, US | 37 |
| University of New Hampshirelocation not on record | 37 |
| Guangzhou, CN | 37 |
| Tsukuba, JP | 37 |
| UIBlocation not on record | 36 |
| Tomioka, JP | 36 |
| ESP119location not on record | 36 |
| Uniwersytet Jagiellońskilocation not on record | 35 |
| BClocation not on record | 34 |
| Vitoria, ES | 33 |
| San Isidro, AR | 32 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 32 |
| Wuhan, CN | 31 |
| Chadron, US | 31 |
| Pamplona, ES | 31 |
| Salamanca, ES | 31 |
| KURAlocation not on record | 30 |
| Rishon Le Zion, IL | 30 |
| Bangkok, TH | 30 |
| Boise, US | 29 |
| Kensington, AU | 29 |
| Montréal, CA | 29 |
| Sanda, JP | 29 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 28 |
| Tula State Universitylocation not on record | 27 |
| Entomological Society of Latvialocation not on record | 27 |
| KFGBlocation not on record | 27 |
| GJOlocation not on record | 26 |
| Pocatello, US | 26 |
| Madrid, ES | 26 |
| Wellington, NZ | 25 |
| UGentlocation not on record | 25 |
| Zürich, CH | 24 |
| Pittsburg, US | 24 |
| IRL001location not on record | 24 |
| Urumqi, CN | 24 |
| University of Alberta Museumslocation not on record | 23 |
| San Luis Obispo, US | 23 |
| Xining, CN | 23 |
| Seoul, KR | 22 |
| Akita Prefectural Museumlocation not on record | 22 |
| Durango, MX | 22 |
| Nagatoro-machi, Chichibu-gun, JP | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| NSMKlocation not on record | 22 |
| Garðabær, IS | 22 |
| Yunnan Universitylocation not on record | 21 |
| Zürich, CH | 21 |
| Bozeman, US | 21 |
| Hiratsuka City Museumlocation not on record | 21 |
| Kawasaki Shi Tama Ku, JP | 21 |
| Armidale, AU | 21 |
| Tampa, US | 20 |
| Provo, US | 20 |
| Green Bay, US | 20 |
| University of Wisconsinlocation not on record | 20 |
| ROM003location not on record | 20 |
| National Institute of Biological Resourceslocation not on record | 19 |
| Iwate Prefectural Museumlocation not on record | 19 |
| Millersville, US | 19 |
| Portland, US | 19 |
| UChlocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Philadelphia, US | 18 |
| Sevilla, ES | 18 |
| Lord Fairfax Community Collegelocation not on record | 17 |
| McWane Science Centerlocation not on record | 16 |
| Alicante, ES | 16 |
| Dover, US | 16 |
| Phyletisches Museum Jenalocation not on record | 16 |
| Chapel Hill, US | 16 |
| Caldwell, US | 16 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 15 |
| Xiamen, CN | 15 |
| Korea National Arboretumlocation not on record | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Phoenix, US | 15 |
| Universidad Nacional de Colombia (UNAL)location not on record | 14 |
| Frankfurt am Main | 14 |
| CASlocation not on record | 14 |
| JP | 14 |
| EL PASO, US | 14 |
| Ashland, US | 14 |
| Toronto, CA | 14 |
| KIRMlocation not on record | 14 |
| Norfolk, US | 14 |
| Fayetteville, US | 13 |
| Grand Junction, US | 13 |
| KR | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| Nanjing, CN | 13 |
| New Brunswick, US | 13 |
| Otaru, JP | 13 |
| Fort Worth, US | 13 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 13 |
| Cheney, US | 13 |
| Dekalb, US | 13 |
| Paris, FR | 13 |
| Saint John, CA | 12 |
| Rotorua, NZ | 12 |
| Kushiro City Museumlocation not on record | 12 |
| Mississippi State, US | 12 |
| J.F.Oberlin Universitylocation not on record | 12 |
| Weber State Universitylocation not on record | 12 |
| Sagamihara, JP | 12 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 12 |
| Tuscaloosa, US | 11 |
| Guilin, CN | 11 |
| ROM023location not on record | 11 |
| US | 11 |
| CJBGlocation not on record | 11 |
| Columbia, US | 11 |
| GB | 11 |
| Urumqi, CN | 11 |
| Museum of the Rockieslocation not on record | 10 |
| Knoxville, US | 10 |
| Strecker Museum, Baylor Universitylocation not on record | 10 |
| Jackson, US | 10 |
| University of Tennessee at Chattanoogalocation not on record | 10 |
| Aarhus, DK | 10 |
| Parthenon Tama History Museumlocation not on record | 10 |
| Cape Town, ZA | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Obihiro Centennial City Museumlocation not on record | 10 |
| Tokushima, JP | 10 |
| BISHlocation not on record | 10 |
| Chicago, US | 9 |
| Yangling, CN | 9 |
| Allentown, US | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| Chicago, US | 9 |
| Sendai, JP | 9 |
| PRClocation not on record | 9 |
| Staten Island, US | 8 |
| Hazara Universitylocation not on record | 8 |
| Keene State Universitylocation not on record | 8 |
| Durango, US | 8 |
| Porrentruy, CH | 8 |
| Badajoz, ES | 8 |
| Frauenfeld, CH | 8 |
| Orem, US | 8 |
| Fairfax, US | 8 |
| Durban, ZA | 8 |
| Durham, US | 8 |
| Lincoln, US | 8 |
| DNSMlocation not on record | 8 |
| Bend, US | 8 |
| Tacoma, US | 8 |
| Davenport, US | 7 |
| DMZ botanic gardenlocation not on record | 7 |
| San Angelo, US | 7 |
| GZUlocation not on record | 7 |
| Porvoo, FI | 7 |
| SWlocation not on record | 7 |
| WINlocation not on record | 7 |
| Institute of the biological problems of the North FEB RASlocation not on record | 7 |
| USFS/BHSClocation not on record | 6 |
| Kandalaksha State Nature Reservelocation not on record | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| Córdoba, AR | 6 |
| Whitehorse, CA | 6 |
| Montecillo, Texcoco, MX | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Mexico City, MX | 6 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 6 |
| IDElocation not on record | 6 |
| Honolulu, US | 6 |
| Wuhan, CN | 6 |
| Johnson City, US | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Taipei, TW | 6 |
| Edinburgh, GB | 6 |
| Changsha, CN | 6 |
| 6 | |
| AUAlocation not on record | 5 |
| Washington, US | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Universidad del Quindío (UniQuindío)location not on record | 5 |
| KIWElocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Stockholm, SE | 5 |
| Torreón, MX | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| USFSlocation not on record | 5 |
| TAIElocation not on record | 5 |
| Xian, CN | 5 |
| Bourges, FR | 5 |
| Royal Botanical Gardenslocation not on record | 5 |
| Muzaffarabad, PK | 5 |
| Loja, EC | 5 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Nishihara, JP | 5 |
| Corrientes, AR | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Emporia, US | 5 |
| Zapopan, MX | 5 |
| Podgorica, ME | 5 |
| Kingston, US | 5 |
| SZUlocation not on record | 5 |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| Kirksville, US | 5 |
| Austin, US | 5 |
| GAlocation not on record | 5 |
| Santa Cruz, US | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| San Jose, US | 4 |
| Kostrzyca Forest Gene Banklocation not on record | 4 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| Macomb, US | 4 |
| Osaka, JP | 4 |
| Chicago, US | 4 |
| KOMlocation not on record | 4 |
| Catalina Island Conservancylocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Science Museum of Minnesotalocation not on record | 4 |
| Parkville, AU | 4 |
| BSBIlocation not on record | 4 |
| Anchorage, US | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Springfield, US | 4 |
| Ciudad de México, MX | 4 |
| QVMAGlocation not on record | 4 |
| BGR001location not on record | 4 |
| Ishikawa Museum of Natural Historylocation not on record | 4 |
| Coimbra, PT | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Palmerston North, NZ | 4 |
| Clemson, US | 4 |
| GMBAlocation not on record | 4 |
| Rovaniemi, FI | 4 |
| Nishihara, JP | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Batemans Bay, AU | 4 |
| SIHUlocation not on record | 4 |
| ESP010location not on record | 4 |
| Ivano-Frankove, UA | 3 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 3 |
| OLAlocation not on record | 3 |
| Smithsonian Institutionlocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Truckee, US | 3 |
| Banyoles, ES | 3 |
| Richmond, US | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| Mexico City, MX | 3 |
| Taipei, TW | 3 |
| Philadelphia, US | 3 |
| H-Schuhwlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Palmerston, AU | 3 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 3 |
| Whitewater, US | 3 |
| nbflocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| KNFHClocation not on record | 3 |
| Northridge, US | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Brookings, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Long Beach, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Henderson, US | 3 |
| Wollongong, AU | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| Granada, ES | 3 |
| Hudson, US | 3 |
| Chapingo, MX | 3 |
| Los Angeles, US | 3 |
| INFlocation not on record | 3 |
| Little Rock, US | 3 |
| Edmonton, CA | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| ESP003location not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Fargo, US | 2 |
| LPMMBHlocation not on record | 2 |
| Ciudad Juárez, MX | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Forssa, FI | 2 |
| VALElocation not on record | 2 |
| Winterthur, CH | 2 |
| BAlocation not on record | 2 |
| STNFlocation not on record | 2 |
| University of Winnipeglocation not on record | 2 |
| Bratislava, SK | 2 |
| Castelar, AR | 2 |
| Taipei, TW | 2 |
| Nijmegen, NL | 2 |
| KNAMlocation not on record | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| Sapporo, JP | 2 |
| The Cattle Museumlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| RJBJCIlocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Riobamba, EC | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Herb. BBGlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 2 |
| California Academy of Scienceslocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| ESP009location not on record | 2 |
| San José, CR | 2 |
| Monastir, TN | 2 |
| NMBU:MINAlocation not on record | 2 |
| Tempe, US | 2 |
| Salvador, BR | 2 |
| IPA/SPlocation not on record | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| Brussel, BE | 2 |
| Yaoundé, CM | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Irvine, US | 2 |
| J. Rusek Collectionlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Bothell, US | 1 |
| Miami, US | 1 |
| Berea Collegelocation not on record | 1 |
| AASlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| STUlocation not on record | 1 |
| San Francisco, US | 1 |
| San Bernardino, US | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| UTPLlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Ojo, NG | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| QCNElocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| University of Alaska Museum of the Northlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| MEXUlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| nlocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Glarus, CH | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Russellville, US | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| UNINE:NEUlocation not on record | 1 |
| Pamplona, ES | 1 |
| Kagoshima, JP | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| cslocation not on record | 1 |
| US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Lausanne, CH | 1 |
| Universität Göttingenlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| KMCClocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| JBSlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Lubbock, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Hamilton, US | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| SVK001location not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| GBR016location not on record | 1 |
| US | 1 |
| DASSHlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Buenos Aires, AR | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Asheville, US | 1 |
| Minia, EG | 1 |
| DULlocation not on record | 1 |
| LfUlocation not on record | 1 |
| COLlocation not on record | 1 |
| LINUlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Valparaíso, CL | 1 |
| University of Wisconsinlocation not on record | 1 |
| Due West, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| ENTClocation not on record | 1 |
| Awka, NG | 1 |
| Harrisonburg, US | 1 |
| Turlock, US | 1 |
| Mount Pleasant, US | 1 |
| Fulda, DE | 1 |
| Ypsilanti, US | 1 |
| PUC-RSlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| USP-IBlocation not on record | 1 |
| Oswego, US | 1 |
542 institutions · 29 018 of 31 363 vouchered records shown · 1 708 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA983 detections
Where the DNA of Dactylis glomerata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found983
Studies independent surveys3
Countries20
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 983 detections have coordinates
Open the map20 countries0
Larch forestcultivated in Botanic Garden; ORIGINAL_HABIT…Oak woodland with Quercus agrifolia, Caloced…grasslandWoodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 7.60–17.8
Seasonal swing summer↔winter22.0 °C
Max temp (day)19.2 °C 10.6–21.8
Min temp (night)12.2 °C 5.20–13.8
Precipitation74.3 mm/mo 56.6–90.0
Air humidity60.6 % 57.7–64.8
Moisture balance-32.8 mm/mo -62.8–12.6
Vapour deficit701 Pa 367–811
Wind speed3.70 m/s 2.60–5.70
Cloud cover39.6 % 33.2–55.8
CHELSA 1981–2010, ~9 km grid, at location & month of 912 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.