Dacryodes rostrata

(Blume) H.J.Lam · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Burseraceae/Dacryodes

At a glance

Occurrence records556

Data sources10

Biological traits21

DNA specimens26

eDNA detections7

Sources10 archives

Databases and archives Dacryodes rostrata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility556 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF556 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI26 specimens

01Narrative

Dacryodes rostrata is a tree in the family Burseraceae. The specific epithet ' is from the Latin meaning "beaked", referring to the narrow-tipped leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height20 m

⚠ sources differ — GIFT: 20 m · TRY: 35 m

Plant height max25 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio40.76 g/g

Leaf c410 mg/g

Leaf n14.46 mg/g

Leaf p0.602 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)15.21 mm²/mg

Wood density542 mg/cm³

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacryodes rostrata has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes5

GenBank sequences7

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLLC736197.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATCTAACCAAAGATACT …

Dacryodes rostrata 2808179 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type556 records

Wild obs. + sensor243

Museum / vouchered313

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 241

242 georeferenced · 1 without coordinates

Open the mapobservation + sensor243

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 312 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	18
Cibinong Science Center, Herbarium Bogorienselocation not on record	13
Honolulu, US	7
ASUlocation not on record	6
Bronx, US	4
Xiamen, CN	1
Cambridge, US	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
UNESP-FCAlocation not on record	1
Edinburgh, GB	1

11 institutions · 54 of 313 vouchered records shown · 259 without an institution code

09Environmental DNA7 detections

Where the DNA of Dacryodes rostrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.3 °C 25.3–26.6

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.0 °C 28.2–29.5

Min temp (night)23.6 °C 22.1–24.6

Precipitation317 mm/mo 217–365

Air humidity69.4 % 68.1–69.9

Moisture balance181 mm/mo 66.8–229

Vapour deficit1,043 Pa 1,000–1,080

Wind speed1.00 m/s 0.8–1.40

Cloud cover51.7 % 45.8–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)