Dacryodes excelsa

Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Burseraceae/Dacryodes

At a glance

Occurrence records122

Data sources11

Biological traits101

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Dacryodes excelsa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility122 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources101 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF122 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Dacryodes excelsa is a tree native to Puerto Rico with a habitat that extends into the Lesser Antilles in the Caribbean region.Tabonuco: 'Dacryodes excelsa' (Vahl.) USDA Forest Service. Retrieved 18 September 2013. Its English vernacular names include gommier and candlewood.Dacryodes excelsa, "Candlewood": Overview. Encyclopedia of Life. Retrieved 18 September 2013. Its Spanish common name is tabonuco.Dacryodes excelsa (Vahl) "Tabonuco": Burseraceae, Familia de las burseras. Ariel E. Lugo & Frank H. Wadsworth. USDA Forest Service. Retrieved 18 September 2013. According to Richards, "it is the most conspicuous large emergent tree" in the Luquillo mountains of Puerto Rico. It is also found in Toro Negro State Forest, in Puerto Rico Cordillera Central.Bosques de Puerto Rico: Bosque Estatal de Toro Negro. Hojas de Nuestro Ambiente. July 2008. [Publication/Issue: P-030] Puerto Rico Department of Natural and Environmental Resources. Retrieved 13 September 2013. Dacryodes excelsa grows to around 115 ft, and grows best in soil with a PH of 4.5–5.5.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology3

Leaf size59 035 mm²

Plant height27.5 m

⚠ sources differ — GIFT: 27.5 m · USDA: 35.05 m · TRY: 35 m

Seed mass12 397 mg

⚠ sources differ — TRY: 12 397 mg · GIFT: 16 800 mg

Life cycle & reproduction26

Bloom periodEarly Summer

Coppice potentialNo

Deciduousnessevergreen

Flower colourgreen

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formtree

Life spanperennial

Lifespan categoryLong

Lifespan years400 years

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Self fertilizationabsent

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring, Summer, Fall

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsNo

Aquaticterrestrial

BloatNone

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Angiosperm

Growth form USDASingle Stem

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min42 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry26

Anaerobic toleranceNone

C:N ratioHigh

Caco3 toleranceNone

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementLow

Fire resistantNo

Fire toleranceLow

Frost free days min365 days

Leaf C:N ratio34.85 g/g

Leaf c439 mg/g

Leaf n13 mg/g

Leaf p0.611 mg/g

Moisture useMedium

Nitrogen fixation levelNone

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Precipitation max160 in

Precipitation min79 in

Salinity toleranceNone

Shade toleranceMedium

Soil pH max5.5 pH

Soil pH min4.5 pH

Specific leaf area (SLA)13.76 mm²/mg

Temperature min50 °F

Wood density496 mg/cm³

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Fuelwood productLow

Lumber productYes

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound27 per lb

ToxicityNone

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

Height at 20yr8.53 m

Planting density max300 per acre

Planting density min170 per acre

03Chemical composition5 compounds

Compounds documented for Dacryodes excelsa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monocyclic monoterpenoids1

Pinane monoterpenoids1

Gallotannins $ Simple phenolic acids1

Aminoacids1

Isocoumarins1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	LOTUS
(2S,4S)-4-Sulfooxypiperidine-2-Carboxylic Acid	present	NPASS
(3S)-1-methyl-3-prop-1-en-2-ylcyclohexene	present	LOTUS
Bergenin	present	NPASS
Gallic acid	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacryodes excelsa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLHM446789.1 ↗513 bpPuerto Rico · 2009

ACGT

ATTGACTTATTATACTCCTGAATATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCACCCGA …

Dacryodes excelsa ribulose-1,5-bisphosphate/carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

07Deep time~3.04 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin3.04 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type122 records

Wild obs. + sensor75

Museum / vouchered47

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 13≤1 km 6≤10 km 16>10 km 18

53 georeferenced · 22 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 47 records without

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	14
Saint Louis, US	10
Monastir, TN	4
Kew, GB	3
University of Stellenboschlocation not on record	3
St. Augustine, TT	3
Tampa, US	2
Paris, FR	1
Clemson, US	1
Burlington, US	1
ASUlocation not on record	1

11 institutions · 43 of 47 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Dacryodes excelsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 24.1–25.3

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.0 °C 28.0–29.2

Min temp (night)20.7 °C 20.7–21.9

Precipitation183 mm/mo 151–183

Air humidity66.7 % 66.5–66.7

Moisture balance23.4 mm/mo -31.7–23.4

Vapour deficit998 Pa 998–1,084

Wind speed2.00 m/s 2.00–2.40

Cloud cover27.4 % 25.9–27.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)