Dacrymyces ovisporus — The Life Data

Fungi/Basidiomycota/Dacrymycetes/Dacrymycetales/Dacrymycetaceae/Dacrymyces

At a glance

Occurrence records161

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Dacrymyces ovisporus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility161 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF161 records

DNA & barcodingNCBIsequences

01Narrative

Dacrymyces ovisporus is a species of fungus in the family Dacrymycetaceae. It was first described scientifically by German mycologist Julius Oscar Brefeld in 1888. The fungus produces roughly spherical to ovoid spores, and both one- and two-spored basidia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacrymyces ovisporus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW191960.1 ↗565 bpNorway

ACGT

TAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGTATTTGCACGTCCATCGCGGCGGCGTATT …

Dacrymyces ovisporus voucher H:Spirin 11145 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS4

fungal barcode

08Occurrence & distribution

Record type161 records

Wild obs. + sensor80

Museum / vouchered81

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 15≤1 km 28≤10 km 28>10 km 2

73 georeferenced · 7 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 15≤1 km 29≤10 km 11>10 km 4

59 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	34
Uppsala, SE	12
Vancouver, CA	7
MAlocation not on record	4
Copenhagen, DK	4
WU-MYClocation not on record	2
Helsinki, FI	2
Philadelphia, US	1
Trondheim, NO	1
Zürich, CH	1
GJOlocation not on record	1
BDBClocation not on record	1
Joensuu, FI	1
Oulu, FI	1
Kew, GB	1
SLU Artdatabankenlocation not on record	1
Trondheim, NO	1

17 institutions · 75 of 81 vouchered records shown · 6 without an institution code