Dacrydium elatum

(Roxb.) Wall. ex Loudon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Dacrydium

At a glance

Occurrence records69

Data sources10

Biological traits21

DNA specimens10

eDNA detections9

Sources10 archives

Databases and archives Dacrydium elatum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~6.41 Gbp↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceGoaT6.4 Gbp

01Narrative

Dacrydium elatum is a species of conifer in the family Podocarpaceae. It is found in Cambodia, Indonesia, Laos, Malaysia, Thailand, and Vietnam. It is a tree up to 30 m tall, with dbh up to 80 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height25 m

⚠ sources differ — GIFT: 25 m · TRY: 30 m

Plant height max40 m

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry5

Leaf n8.38 mg/g

Leaf p0.43 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density505 mg/cm³

⚠ sources differ — TRY: 505 mg/cm³ · GIFT: 643 mg/cm³

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacrydium elatum has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections9

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM886365.1 ↗593 bp

ACGT

CCCCCAAACAGAGACTAAAGCAAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAA …

Dacrydium elatum isolate VNMN.Podo2 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK4★rbcL6★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Dacrydium elatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 405 900 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Dacrydium elatum6.41 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type69 records

Wild obs. + sensor12

Museum / vouchered56

Other1

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 5≤1 km 4≤10 km 1>10 km 2

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	6
Moscow State Universitylocation not on record	3
South Kensington, GB	3
EL PASO, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Kunming, CN	1
Xiamen, CN	1
National Institute of Biological Resourceslocation not on record	1
Canadian Department of Agriculturelocation not on record	1

9 institutions · 19 of 56 vouchered records shown · 35 without an institution code

09Environmental DNA9 detections

Where the DNA of Dacrydium elatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.2–25.2

Seasonal swing summer↔winter6.00 °C

Max temp (day)29.6 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity63.4 %

Moisture balance21.8 mm/mo

Vapour deficit1,175 Pa

Wind speed3.20 m/s

Cloud cover64.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)