Dacrycarpus imbricatus

(Blume) de Laub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Dacrycarpus

At a glance

Occurrence records974

Data sources12

Biological traits25

DNA specimens29

eDNA detections30

Sources12 archives

Databases and archives Dacrycarpus imbricatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility974 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionLOTUS · NPASS53 compounds

Occurrence & distributionGBIF974 records

Environmental DNA1 datasets · 3 countries30 detections

DNA & barcodingBOLD · NCBI29 specimens

Genome at a glanceCCDB5.2 Gbp

01Narrative

Dacrycarpus imbricatus est une espèce de plantes de la famille des Podocarpaceae. C'est un conifère originaire d'Asie du Sud-Est.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height40 m

⚠ sources differ — GIFT: 40 m · TRY: 27 m

Plant height max40 m

Seed mass54.95 mg

Seed mass max54.95 mg

Seed mass min54.95 mg

Life cycle & reproduction7

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry5

Leaf n12.3 mg/g

Leaf p0.65 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density436 mg/cm³

⚠ sources differ — TRY: 436 mg/cm³ · GIFT: 510 mg/cm³

03Chemical composition53 compounds

Compounds documented for Dacrycarpus imbricatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones5

Stigmastane steroids4

Bisabolane sesquiterpenoids3

Oxo fatty acids2

Oxygenated hydrocarbons2

Documented compounds53 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,4S)-1-methyl-4-[(2S)-6-methylhept-5-en-2-yl]cyclohexane-1,2,4-triol	present	NPASS
(2R,3aR,6E,6aS)-2-heptadecyl-3a-methyl-6-octadecylidene-6aH-furo[2,3-d][1,3]dioxol-5-one	present	NPASS
(2R,3R)-2-[(3S,5R)-3,5-dimethyl-2-methylidene-6-[[(2R,3R)-3-(4-methylphenyl)oxiran-2-yl]methyl]hept-6-enyl]-3-(4-methylphenyl)oxirane	present	NPASS
(2R,3S,4R,5R)-2-butoxy-2-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,5R,10R,13R,14S)-2,3,14-Trihydroxy-10,13-Dimethyl-17-[(2R,3R)-2,3,6-Trihydroxy-6-Methylheptan-2-Yl]-2,3,4,5,9,11,12,15,16,17-Decahydro-1H-Cyclopenta[A]Phenanthren-6-One	present	NPASS
(2S,3S)-2-[(3R,5S)-3,5-dimethyl-2-methylidene-6-[[(2S,3S)-3-(4-methylphenyl)oxiran-2-yl]methyl]hept-6-enyl]-3-(4-methylphenyl)oxirane	present	NPASS
(2S,4aS,10aR)-2,6-dihydroxy-1,1,4a-trimethyl-7-propan-2-yl-3,4,10,10a-tetrahydro-2H-phenanthren-9-one	present	NPASS
(3E,4R,5R)-4-hydroxy-5-methoxy-5-methyl-3-octadecylideneoxolan-2-one	present	NPASS
(3Z,4R,5R)-4-hydroxy-5-methoxy-5-methyl-3-octadecylideneoxolan-2-one	present	NPASS
(3Z,4S)-4-hydroxy-5-methylidene-3-octadecylideneoxolan-2-one	present	NPASS

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacrycarpus imbricatus has left across the world's sequence archives.

At a glance

DNA specimens29

Marker genes5

GenBank sequences9

eDNA detections30

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG730470.1 ↗435 bp

ACGT

TGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCCCGGCCGAGGGCACGTCTGCCTGGGCGACGCACCATCG …

Dacrycarpus imbricatus var. patulus voucher 724 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL5★ITS3★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dacrycarpus imbricatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 232 300 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Dacrycarpus imbricatus5.23 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · Cave1958

CCDB · ipcn-api-dl — Zhou, Q. x. & Z. j. Gu. 2001. Karyomorphology of Podocarpus s.l. in China and its systematic significance. Caryologia 54: 121–127.

CCDB · Cave1958 — Hair & Beuzen. 1958a

n 101×CCDB · Cave1958

CCDB · Cave1958 — Hair & Beuzen. 1958a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type974 records

Wild obs. + sensor98

Museum / vouchered719

Cultivated / captive6

Other151

Origin

Native2

Range

Area of Occupancy AOO1 612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 36≤1 km 10≤10 km 9>10 km 9

64 georeferenced · 34 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 3≤1 km 39≤10 km 116>10 km 20

178 georeferenced · 541 without coordinates

Open the institutions mapphysical evidence719

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dresden, DE	207
Canberra, AU	103
Kew, GB	69
Saint Louis, US	42
Brisbane, AU	32
Edinburgh, GB	24
John T. Waterhouse Herbariumlocation not on record	20
Auckland, NZ	15
Museo Entomologico de Leonlocation not on record	10
Bronx, US	9
Smithfield, AU	6
Honolulu, US	6
Guangzhou, CN	5
Vietnam Academy of Science and Technology (VAST)location not on record	4
Servico de Microbiologia e Imunologialocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
BISHlocation not on record	3
Durham, US	2
Kunming, CN	2
Mount Annan, AU	2
Berlin, DE	2
Changsha, CN	2
Paris, FR	2
Christchurch, NZ	2
University of Sydneylocation not on record	1
University of Stellenboschlocation not on record	1
Columbia, US	1
PNHlocation not on record	1
Rotorua, NZ	1
Canadian Department of Agriculturelocation not on record	1
Llocation not on record	1
Taipei, TW	1
Herbarium of South China Botanical Gardenlocation not on record	1
Universidad de La Sallelocation not on record	1
Hobart, AU	1
Cambridge, US	1
ASUlocation not on record	1
Fort Worth, US	1

38 institutions · 590 of 719 vouchered records shown · 126 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA30 detections

Where the DNA of Dacrycarpus imbricatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 18.6–25.7

Seasonal swing summer↔winter6.00 °C

Max temp (day)29.6 °C 21.8–29.8

Min temp (night)21.3 °C 14.7–22.0

Precipitation254 mm/mo 164–367

Air humidity66.5 % 63.4–70.1

Moisture balance113 mm/mo 21.8–260

Vapour deficit1,093 Pa 674–1,175

Wind speed3.20 m/s 1.40–3.50

Cloud cover60.7 % 54.9–64.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)