Dacrycarpus cinctus — The Life Data

Plantae/Tracheophyta/Pinopsida/Pinales/Podocarpaceae/Dacrycarpus

At a glance

Occurrence records174

Data sources8

Biological traits17

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Dacrycarpus cinctus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF174 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Dacrycarpus cinctus is a species of conifer in the family Podocarpaceae. It is found in Indonesia and Papua New Guinea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n13.1 mg/g

Leaf p0.83 mg/g

Photosynthetic pathwayC3

Wood density460 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dacrycarpus cinctus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLHM593601.1 ↗1 334 bp

ACGT

AAACTAAAGCAAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATA …

Dacrycarpus cinctus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

08Occurrence & distribution

Record type174 records

Museum / vouchered105

Other69

Range

Area of Occupancy AOO404 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence105

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	29
Edinburgh, GB	9
Honolulu, US	7
University of Stellenboschlocation not on record	6
Saint Louis, US	2
Auckland, NZ	2
MeiseBGlocation not on record	1
Christchurch, NZ	1
Rotorua, NZ	1

9 institutions · 58 of 105 vouchered records shown · 47 without an institution code

09Environmental DNA2 detections

Where the DNA of Dacrycarpus cinctus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.