Cytospora populina

(Pers.) Rabenh. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Valsaceae/Cytospora

At a glance

Occurrence records244

Data sources9

Biological traits0

DNA specimens0

eDNA detections23

Sources9 archives

Databases and archives Cytospora populina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility244 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF244 records

Environmental DNA5 datasets · 6 countries23 detections

DNA & barcodingNCBIsequences

01Narrative

Valsa ambiens is a plant pathogen infecting elms.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Cytospora populina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Naphthalenones2

Hydroxy fatty acids1

Unsaturated fatty acids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
((2R)-2,3-dihydroxypropyl) (2E,4E,8E,13S)-13-hydroxytetradeca-2,4,8-trienoate	present	LOTUS
((2S)-2,3-dihydroxypropyl) (2E,4E,8E,13S)-13-hydroxytetradeca-2,4,8-trienoate	present	LOTUS
(2E,4E,8E,13S)-13-hydroxytetradeca-2,4,8-trienoic acid	present	LOTUS
(2S)-1,2,3,6-tetrahydroxyheptadeca-5,7,9-trien-4-one	present	LOTUS
2-[(2S)-1,2,3-trihydroxypropyl]tetradeca-2,4,6-trienoic acid	present	LOTUS
3,4-Dihydro-3,6,8-trihydoroxy-1(2H)-napthalenone	present	LOTUS
3-Methylorcylaldehyde	present	LOTUS
Scytalone	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytospora populina has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections23

Countries6

The DNA barcodea real sequence read deposited for this species

ITSKY051973.1 ↗362 bpSwitzerland

ACGT

AGGCGCACCCAGAAACCCTTTGTGAACTTATACCTACATCGTTGCCTCGGCGCTGGCTGCCTCTCCCCTCGGGGAGGGGGCCCTGCTCCT …

Cytospora populina strain CPC 28375 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type244 records

Wild obs. + sensor165

Museum / vouchered79

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 32≤1 km 8≤10 km 125

165 georeferenced

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 3≤1 km 17≤10 km 23>10 km 3

46 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	24
WU-MYClocation not on record	22
Bronx, US	8
Bernard Price Institute for Palaeontological Researchlocation not on record	6
CA	2
Catholic University of Pekinglocation not on record	2
Copenhagen, DK	2
Museo de La Platalocation not on record	1
Lincoln, US	1
SLU Artdatabankenlocation not on record	1
Karlsruhe, DE	1

11 institutions · 70 of 79 vouchered records shown · 9 without an institution code

09Environmental DNA23 detections

Where the DNA of Cytospora populina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys5

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 7.30–22.0

Seasonal swing summer↔winter22.8 °C

Max temp (day)19.0 °C 10.8–27.6

Min temp (night)10.7 °C 3.40–13.9

Precipitation71.6 mm/mo 5.50–120

Air humidity59.4 % 39.8–61.5

Moisture balance-36.0 mm/mo -124–44.1

Vapour deficit705 Pa 426–1,940

Wind speed2.60 m/s 2.40–4.20

Cloud cover40.1 % 21.6–45.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)