Cytisus supranubius

(L.f.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cytisus

At a glance

Occurrence records557

Data sources11

Biological traits22

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Cytisus supranubius's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF557 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT1.1 Gbp

01Narrative

Der Teideginster (Cytisus supranubius, Syn.: Spartocytisus supranubius) ist eine Pflanzenart aus der Gattung Cytisus und gehört zur Familie der Hülsenfrüchtler (Fabaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length max40 mm

Fruit length min25 mm

Leaf length max10 mm

Plant height max4 m

Plant height min2 m

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscencedehiscent

Flower colourpink

Flowering endJun

Flowering startMay

Life formshrub

Life spanperennial

Lifespan years14 years

Habitat & environment8

Climatesubtropical

Elevation max2 200 m

Elevation min1 700 m

Fruit colourblack

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: p

Leaf formlinear

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytisus supranubius has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSZ72251.1 ↗220 bp

ACGT

CATCGTTGCCCCAGTGCCTTGGCCACGTGCTAGGCACCGAGTGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAA …

Spartocytisus supranubius ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Cytisus supranubius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 090 470 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cytisus supranubius1.09 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy4× tetraploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type557 records

Wild obs. + sensor530

Museum / vouchered27

Range

Area of Occupancy AOO364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 222≤1 km 89≤10 km 32>10 km 39

382 georeferenced · 148 without coordinates

Open the mapobservation + sensor530

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	7
University of Stellenboschlocation not on record	4
South Kensington, GB	4
Barcelona, ES	3
Canadian Department of Agriculturelocation not on record	2
Montréal, CA	2
Museo Achille Folettolocation not on record	2
Moscow State Universitylocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
BClocation not on record	1

10 institutions · 27 of 27 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Cytisus supranubius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)