Cytisus scoparius
(L.) Link · speciesAt a glance
Occurrence records426 926
Data sources16
Biological traits157
DNA specimens58
eDNA detections32
Sources16 archives
Databases and archives Cytisus scoparius's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility426 926 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics58 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources157 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS241 compounds
Occurrence & distributionGBIF426 926 records
Environmental DNA1 datasets · 6 countries32 detections
DNA & barcodingBOLD · NCBI58 specimens
Genome at a glanceCCDB · GIFT · GoaT1 Gbp
01Narrative
Cytisus scoparius (syn. Sarothamnus scoparius), the common broom or Scotch broom, is a deciduous leguminous shrub native to western and central Europe. In Britain and Ireland, the standard name is broom; this name is also used for other members of the Genisteae tribe, such as French broom or Spanish broom; and the term common broom is sometimes used for clarification. In other English-speaking countries, the most common name is "Scotch broom" (or Scots broom); however, it is known as English broom in Australia.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology29
Fruit length32.5 mm
⚠ sources differ — AusTraits: 32.5 mm · GIFT: 38 mm
Fruit length max50 mm
Fruit length min20 mm
Fruit width9 mm
Fruit width max12 mm
Fruit width min7 mm
Leaf length13 mm
Leaf length max20 mm
Leaf length min4 mm
Leaf size115 mm²
⚠ sources differ — TRY: 115 mm² · LEDA: 19.6 mm² · GIFT: 19.6 mm²
Leaf width4.75 mm
Leaf width max8 mm
Leaf width min1 mm
Plant height1.72 m
⚠ sources differ — GIFT: 1.72 m · AusTraits: 2.5 m · LEDA: 1.25 m · USDA: 2.13 m · TRY: 1.34 m
Plant height generative1.29 m
Plant height max4 m
Plant height min0.3 m
Seed length3.59 mm
⚠ sources differ — TRY: 3.59 mm · AusTraits: 3 mm · GIFT: 3 mm
Seed length max7 mm
Seed length min3 mm
Seed mass8.49 mg
⚠ sources differ — TRY: 8.49 mg · LEDA: 7.97 mg · GIFT: 7.96 mg
Seed mass max12.8 mg
Seed mass min2.8 mg
Seed volume8.8 mm³
Seed volume max8.8 mm³
Seed volume min8.8 mm³
Seed width2.25 mm
Seed width max4 mm
Seed width min2 mm
Life cycle & reproduction39
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: E · GIFT: variable
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — AusTraits: myrmecochory · LEDA: dysochor · GIFT: autochorous
Flower colouryellow
Flower conspicuousYes
Flower length max25 mm
Flower length min20 mm
Flowering endJun
Flowering startMay
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formshrub
Life spanperennial
Lifespan categoryModerate
Lifespan years8 years
⚠ sources differ — TRY: 8 years · GIFT: 15 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed spread rateRapid
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment35
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 100 m
Elevation mean1 402 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureMedium
Fruit colourblack
Fruit fleshinessdry
Fruit typelegume
Growth formshrub
Growth form USDAMultiple Stem
Habitat GIFTforest
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesscompound
Leaf formelliptic
Leaf retentionNo
Leaf shapenarrowly_elliptical obovate
Low growing grassNo
Mycorrhizapresent
Mycorrhiza typearbuscular
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry29
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min150 days
Leaf C:N ratio16.65 g/g
Leaf c459 mg/g
Leaf dry-matter content (LDMC)257 mg/g
⚠ sources differ — TRY: 257 mg/g · LEDA: 200 mg/g
Leaf n28.98 mg/g
Leaf p1.17 mg/g
Moisture useLow
Nitrogen fixation levelHigh
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min30 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5.5 pH
Specific leaf area (SLA)12.58 mm²/mg
⚠ sources differ — TRY: 12.58 mm²/mg · LEDA: 15.5 mm²/mg · GIFT: 14.53 mm²/mg
Temperature min-13 °F
Wood density530 mg/cm³
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound57 000 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr2.13 m
Planting density max2 700 per acre
Planting density min1 200 per acre
Seeds per fruit>1000
03Chemical composition241 compounds
Compounds documented for Cytisus scoparius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented🌿 Tea
Compound class profile5 classes
Cardenolides46
Quinolizidine alkaloids35
Ursane and Taraxastane triterpenoids15
Cytochalasan alkaloids11
Pregnane steroids5
Documented compounds241 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| PROTEIN | 325,000 ppm | DukesPhytochem | |
| FAT | 60,000 ppm | DukesPhytochem | |
| ASH | 38,000 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 30,960 ppm | DukesPhytochem | |
| SPARTEINE | 15,000 ppm | DukesPhytochem |
05DNA & barcoding58 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytisus scoparius has left across the world's sequence archives.
At a glance
DNA specimens58
Marker genes8
GenBank sequences10
eDNA detections32
Countries7
The DNA barcodea real sequence read deposited for this species
CCCAAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCAGTGCCCTGGCCACGTGCTAGGCACCAAGTGGGGC …
Cytisus scoparius voucher SW133WEP 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL4★rbcLa★trnL-F★ITS3★ITS2cp-trnL-intron
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Cytisus scoparius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 026 900 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cytisus scoparius1.03 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 46 n = 23
Ploidy4× tetraploid · measured
Chromosome records24–482n range46median46mode71records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4637×CCDB · slov-fl · CCDB · brit-fl · CCDB · iber-fl +12
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Gill, J.J.B., Walker, S. Watsonia 8: 345-356 (1971)
CCDB · brit-fl — Bocher, T.W., Larsen, K. New Phytol. 57: 311-317 (1958)
CCDB · brit-fl — Bocher, T.W., Larsen, K. Bot. Tidsskr. 52: 125-132 (1955)
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 504-515. Gonzlez Zapatero, M. A., J. A. Elena- Rossell & F. Navarro Andrs.Lagascalia15(1): 112-119(1988).
CCDB · fl-europaea — Skalinska et al.,
CCDB · fl-europaea — BOcher & Larsen,
CCDB · poland — Skali?ska M. et al. 1964. Additions to chromosome numbers of Polish Angiosperms (Fifth contribution). Acta Soc. Bot. Pol. 33, 45-76.
CCDB · mediterranean
CCDB · ipcn-api-dl — González Zapatero, M. A., J. A. Elena-Roselló & F. N. Andrés. 1988. Números cromosómicos para la flora Española. 504--515. Lagascalia 15: 112–119.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — López Pacheco, M. J. 2002. Números cromosomáticos de plantas occidentales, 921--936. Anales Jard. Bot. Madrid 59(2): 287–288.
CCDB · ipcn-api-dl — Kodama, A. 1977. Karyological and morphological observations on root nodules of some woody and herbaceous leguminous plants. Bull. Hiroshima Agric. Coll. 5: 389–394.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Semerenko, L. V. & I. V. Shvets. 1989. Karyologicheskoe isuchenie bobovykh (Fabaceae) Belorussii. Pp. 66--68 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Semerenko, L. V. & P. Y. Blazhevich. 1979. Analysis of karyotypes of some species (Fabaceae Lindl.) of the Byelorussian flora. Izv. Akad. Nauk. Belorussk SSR. Ser. Biol. Nauk (Minsk). (In Russian).
CCDB · ipcn-api-dl — Vachova, M. 1974a. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — ZIELINSKI, J. 1975. The genus Cytisus L. s.1. in Poland. Arbor. Kornickie 20: 47–111.
CCDB · book-ipcn67-71 — GILL, J.J.B., & s. WALKER. 1971. Studies on Cytisus scoparius (L.) Link with particular reference to the prostrate forms. watsonia 8: 345-356.
CCDB · book-ipcn75-78 — Vachova 1974a
CCDB · book-ipcn75-78 — Vachova 1974b
CCDB · book-ipcn75-78 — Zielinski 1975
CCDB · book-northern-plants — Maude 1939, 1940.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Bocher, T .W. & Larsen, K. 1958c ; Skali6.ska, M. et al. 1964
CCDB · book-indian_vol1 — Maude, P.F. 1940 ; Gilot, J 1965 ; Taylor, R.L. & Mulligan, G .A. 1968 ; Gill, J.J.B. & Walker, S. 1971; Forissier, R. 1973
CCDB · book-atlas-flowering-plants — Maude 1940
CCDB · CromoCat 2015 — Gill, J. J. B. & Walker, S. (1971). Studies on Cytisus scoparius (L.) Link with particular reference to the prostrate forms. Watsonia 8: 345-356.
CCDB · CromoCat 2015 — González Zapatero, M. A., Elena- Rosselló, J. A. & Navarro Andrés, F. (1988). Números cromosómicos para la flora española, 504-515. Lagascalia 15(1): 112-119.
CCDB · CromoCat 2015 — López Pacheco, M. J. (2001). Números cromosomáticos de plantas occidentales, 921-936. Anales Jard. Bot. Madrid 59(2): 287-288.
CCDB · CromoCat 2015 — Yeh, M.S., H. Yuasa & F. Maekawa. (1986). Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57-71.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Horjales, M. (1975). Números cromosómicos en genisteas, II. Trab. Dept. Bot. Fisiol. Veg. Madrid 7: 43-50.
GIFT · GIFT (floras)
2n 4830×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Adams, F.W. Watsonia 4: 17-18 (1957)
CCDB · brit-fl — Morton, J.K. New Phytol. 54: 68-69 (1955)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 252: 79-164(1978).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Fernandes, A. & M. F. Santos.Bol. Soc. Brot. ser. 249: 173-196(1975).
CCDB · iber-fl — Nmeros cromosmicos en genisteas. Horjales, M.Anales Inst. Bot. Cavanilles31(1): 175-178(1974).
CCDB · ipcn-api-dl — Afzal-rafii, Z., M. P. Bosc & J. Viano. 1986. Investigations cytogénétiques de quelques plantes médicinales des massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Vég., Bot. 9: 251–262.
CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & H. FATIMA. 1975. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosae (Suppl. 1). Bol. Soc. Brot., sér. 2 49: 173–196.
CCDB · ipcn-api-dl — Fernandes, A., M. F. SANTOS & M. QUEIROS. 1977. Contribution à la connaissance cytotaxonomique des Spermatophyta de Portugal. Leguminosae. Bol. Soc. Brot., sér. 2 51: 137–186.
CCDB · ipcn-api-dl — HORJALES, M. 1974. Numeros cromosomicos en genesteas. Anales Inst. Bot. Cavanilles 31: 175–178.
CCDB · book-northern-plants — Sugiura 1931.
CCDB · book-indian_vol1 — Tischler, G. 1934 ; Rohweder, H. 1937, Bocher, T.W. & Larsen, K. 1955 ; Adams, F.W. 1957
CCDB · book-indian_vol1 — Kawakami, I. 1930 ; Sugiura; T. 1931, 1936b ; Castro, D. de 1949 ; Horjales, M. 1974
CCDB · book-indian_vol1 — Sanudo, A. 1973
CCDB · book-atlas-flowering-plants
CCDB · kew — Mowforth MA.1986. Variation in nuclear DNA amounts in flowering plants: an ecological analysis. PhD. Thesis, University of Sheffield. Specific reference for Poa annua in Mowforth MA and Grime JP. 1989. Intra-Population Variation in Nuclear DNA Amount
CCDB · Cave1957 — Adame
CCDB · CromoCat 2015 — Afzal-Rafii, Z., M. P. Bosc & J. Viano. (1986). Investigations cytogénétiques de quelques plantes médicinales des massifs du Lubéron, de Lure et du Mont Ventoux. Rev. Cytol. Biol. Vég. Botaniste 9: 251-262.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.
CCDB · CromoCat 2015 — Fernandes, A. & Santos, M. F. (1975). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. IV. Leguminosae, suppl. 1 Bol. Soc. Brot. 49: 173-196.
CCDB · CromoCat 2015 — Fernandes, A., Santos, M. F. & Queirós, M. (1977a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 51: 137-186.
CCDB · CromoCat 2015 — Horjales, M. (1974). Números cromosómicos en genisteas. Anales Inst. Bot. Cavanilles 31(1): 175-178.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Sañudo, A. (1973b). Variabilidad cromosómica de las genisteas de la flora española en relación con su ecología. Nota previa sobre los géneros Cytisus L. y Adenocarpus DC. Cuad. Ci. Biol. 2: 37-38.
CCDB · CromoCat 2015 — Horjales, M. (1975). Números cromosómicos en genisteas, II. Trab. Dept. Bot. Fisiol. Veg. Madrid 7: 43-50.
GIFT · GIFT (floras)
2n 243×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · GIFT · GIFT (floras)
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Morton, J.K. New Phytol. 54: 68-69 (1955)
GIFT · GIFT (floras)
2n 261×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
n 239×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3
CCDB · ipcn-api-dl — Cubas, P., H. Tahiri & C. Pardo. 2001. Karyological and taxonomic notes on Cytisus Desf. sect. Spartopsis Dumort. and sect. Alburnoides DC. (Genisteae, Leguminosae) from the Iberian Peninsula and Morocco. Bot. J. Linn. Soc. 135(1): 43–50.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn75-78 — NA
CCDB · book-ipcn73-74 — SANUDO, A. 1973. Variabilidad cromosomica de las Genisteas de la fl espanola en relacion con su ecologia. I. Numero y comportamiento de 1 cromosomas durante la meiosis. E. Genera cytisus L. Bal. R. soc. Espanola Hist. Nat. (Biol.) 71: 341-355.
CCDB · Cannon, 2015 — Semerenko, L. V. & P. Y. Blazhevich., 1979
CCDB · CromoCat 2015 — Forissier, R. (1973a). Recherches cytotaxonomiques préliminaires sur les genres Lembotropis, Cytisus, Chamaecytisus, Genista et Chamaespartium. Bull. Soc. Neuchât. Sci. Nat. 96: 51-65.
CCDB · CromoCat 2015 — Sañudo, A. (1973a). Variabilidad cromosómica de las Genisteas de la flora española en relacción con su ecología. I. Bol. Real Soc. Esp. Hist. Nat., Secc. Biol. 71: 341-355.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 243×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Afzal-rafii, Z., M. P. Bosc & J. Viano. 1986. Investigations cytogénétiques de quelques plantes médicinales des massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Vég., Bot. 9: 251–262.
CCDB · CromoCat 2015 — Afzal-Rafii, Z., M. P. Bosc & J. Viano. (1986). Investigations cytogénétiques de quelques plantes médicinales des massifs du Lubéron, de Lure et du Mont Ventoux. Rev. Cytol. Biol. Vég. Botaniste 9: 251-262.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 322×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Variabilidad cromosmica de las Genisteas de la flora espaola en relaccin con su ecologa. I. Saudo, A.Bol. Soc. Esp. Hist. Nat.71: 341-355(1973).
CCDB · CromoCat 2015 — Sañudo, A. (1973a). Variabilidad cromosómica de las Genisteas de la flora española en relacción con su ecología. I. Bol. Real Soc. Esp. Hist. Nat., Secc. Biol. 71: 341-355.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type426 926 records
Wild obs. + sensor419 921
Museum / vouchered5 247
Cultivated / captive1 208
Other550
Origin
Native21 008
Introduced12 096
Range
Area of Occupancy AOO376 632 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 80 003≤1 km 73 244≤10 km 203 644>10 km 2 615
359 506 georeferenced · 60 415 without coordinates
Open the mapobservation + sensor419 921
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 350≤1 km 1 055≤10 km 1 258>10 km 103
2 766 georeferenced · 2 481 without coordinates
Open the institutions mapphysical evidence5 247
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤1 km 2>10 km 12
14 georeferenced · 1 194 without coordinates
Open the mapnot free-living1 208
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions168 of 280 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 631 |
| LDlocation not on record | 333 |
| BFLlocation not on record | 322 |
| MAlocation not on record | 173 |
| MeiseBGlocation not on record | 158 |
| Adelaide, AU | 148 |
| CICYTEXlocation not on record | 138 |
| Christchurch, NZ | 116 |
| Xiamen, CN | 105 |
| Olocation not on record | 102 |
| Museo Entomologico de Leonlocation not on record | 100 |
| Pullman, US | 94 |
| Oskarshamn, SE | 86 |
| Canberra, AU | 76 |
| Mount Annan, AU | 75 |
| KMNlocation not on record | 74 |
| WTUlocation not on record | 63 |
| Hobart, AU | 59 |
| Corvallis, US | 54 |
| SLU Artdatabankenlocation not on record | 45 |
| Entomological Society of Latvialocation not on record | 43 |
| València, ES | 43 |
| Canadian Department of Agriculturelocation not on record | 40 |
| Görlitz, DE | 38 |
| Auckland, NZ | 37 |
| Barcelona, ES | 35 |
| Bronx, US | 35 |
| Vancouver, CA | 35 |
| Salamanca, ES | 34 |
| South Kensington, GB | 34 |
| Karlsruhe, DE | 33 |
| Davis, US | 29 |
| Riverside, US | 29 |
| Bergen, NO | 28 |
| Arcata, US | 26 |
| Berlin, DE | 26 |
| Williamsburg, US | 24 |
| Acadia Universitylocation not on record | 23 |
| Bern, CH | 23 |
| BRNUlocation not on record | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 22 |
| Durban, ZA | 22 |
| Philadelphia, US | 22 |
| Santiago de Compostela, ES | 21 |
| Moscow State Universitylocation not on record | 21 |
| Córdoba, ES | 21 |
| Claremont, US | 21 |
| Armidale, AU | 20 |
| Pretoria, ZA | 19 |
| Helsinki, FI | 19 |
| Portland, US | 19 |
| Trondheim, NO | 18 |
| Rotorua, NZ | 17 |
| BClocation not on record | 17 |
| Provincia di Livornolocation not on record | 17 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 17 |
| Victoria, CA | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Norfolk, US | 16 |
| Moscow, US | 16 |
| College Park, US | 15 |
| UGentlocation not on record | 15 |
| Wlocation not on record | 14 |
| Odawara, JP | 14 |
| Museo Achille Folettolocation not on record | 13 |
| Chapel Hill, US | 13 |
| Jaén, ES | 13 |
| Brisbane, AU | 13 |
| Jena Microbial Resource Collectionlocation not on record | 13 |
| Salzburg, AT | 12 |
| Badajoz, ES | 12 |
| Saint Louis, US | 12 |
| Wellington, NZ | 12 |
| Chongqing Museumlocation not on record | 12 |
| Angwin, US | 11 |
| Frankfurt am Main | 10 |
| Boise, US | 10 |
| Beijing, CN | 10 |
| Bangkok, TH | 10 |
| Sanda, JP | 10 |
| Tacoma, US | 10 |
| San Sebastián, ES | 9 |
| Pamplona, ES | 9 |
| Durham, US | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| San Francisco, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| ASUlocation not on record | 8 |
| Tilburg, NL | 8 |
| Flagstaff, US | 8 |
| Kew, GB | 8 |
| IDElocation not on record | 8 |
| University of Stellenboschlocation not on record | 7 |
| Ashland, US | 7 |
| San Diego, US | 7 |
| Porrentruy, CH | 7 |
| Madrid, ES | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| CASlocation not on record | 7 |
| Wuzhou, CN | 7 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 7 |
| Santa Cruz, US | 6 |
| Parkville, AU | 6 |
| Hiratsuka City Museumlocation not on record | 6 |
| Shinshu Universitylocation not on record | 6 |
| Cheney, US | 6 |
| Turku, FI | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Nagano City, JP | 5 |
| Tokushima, JP | 5 |
| Podgorica, ME | 5 |
| Zürich, CH | 5 |
| Staten Island, US | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| EL PASO, US | 5 |
| Tsukuba, JP | 5 |
| Santa Barbara, US | 4 |
| Columbia, US | 4 |
| NMBU:MINAlocation not on record | 4 |
| Sevilla, ES | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| GZUlocation not on record | 4 |
| Granada, ES | 4 |
| Knoxville, US | 4 |
| Bloomington, US | 4 |
| Dresden, DE | 4 |
| Bend, US | 4 |
| GJOlocation not on record | 4 |
| New Haven, US | 4 |
| Zürich, CH | 4 |
| Henry Brockhouse Collectionlocation not on record | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| University of British Columbia, Herbariumlocation not on record | 4 |
| San Jose, US | 4 |
| Córdoba, AR | 3 |
| PRClocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Sion, CH | 3 |
| BGBMlocation not on record | 3 |
| Tomioka, JP | 3 |
| KNFHClocation not on record | 3 |
| University of New Hampshirelocation not on record | 3 |
| Dekalb, US | 3 |
| Stockholm, SE | 3 |
| Otaru, JP | 3 |
| San Isidro, AR | 3 |
| Portland, US | 3 |
| Bothell, US | 3 |
| Walla Walla, US | 3 |
| US | 3 |
| Long Beach, US | 3 |
| Fukushima Universitylocation not on record | 3 |
| Fulda, DE | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Universidad Católica de Santa Maríalocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Alicante, ES | 3 |
| Toyama, JP | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Palmerston North, NZ | 3 |
| Northridge, US | 3 |
| BISHlocation not on record | 3 |
| HJAEFlocation not on record | 2 |
| Chiba, JP | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Bourges, FR | 2 |
| ISAlocation not on record | 2 |
| Austin, US | 2 |
| Ann Arbor, US | 2 |
| GB | 2 |
| Phoenix, US | 2 |
| Turlock, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Kochi, JP | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Richmond, US | 2 |
| Uppsala, SE | 2 |
| Tartu, EE | 2 |
| QVMAGlocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Lausanne, CH | 2 |
| Emporia, US | 2 |
| KNFYlocation not on record | 2 |
| TROMlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Denver, US | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Logan, US | 2 |
| Wollongong, AU | 2 |
| Fairfax, US | 2 |
| Mlocation not on record | 2 |
| Minia, EG | 2 |
| GAlocation not on record | 2 |
| Porto Alegre, BR | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Clemson, US | 2 |
| Davenport, US | 2 |
| JBAlocation not on record | 2 |
| Nijmegen, NL | 1 |
| Bando, JP | 1 |
| Due West, US | 1 |
| Sendai, JP | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Missoula, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Castelar, AR | 1 |
| Oswego, US | 1 |
| Fullerton, US | 1 |
| Nishihara, JP | 1 |
| sonstHerblocation not on record | 1 |
| Asheville, US | 1 |
| Paris, FR | 1 |
| Pittsburg, US | 1 |
| KOMlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Kensington, AU | 1 |
| Corrientes, AR | 1 |
| La Paz, BO | 1 |
| NMWlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| SZUlocation not on record | 1 |
| Saint John, CA | 1 |
| Mississippi State, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| KURAlocation not on record | 1 |
| Millersville, US | 1 |
| KNFSClocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| FFPRIlocation not on record | 1 |
| Kuopio, FI | 1 |
| Valparaiso, CL | 1 |
| Sagamihara, JP | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Oulu, FI | 1 |
| nbflocation not on record | 1 |
| Washington, US | 1 |
| San Angelo, US | 1 |
| Coimbra, PT | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Namur, BE | 1 |
| BAYLUlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Batemans Bay, AU | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| OLAlocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Madrid, ES | 1 |
| Cape Town, ZA | 1 |
| Edmonton, CA | 1 |
| Bozeman, US | 1 |
| Mohonk Preservelocation not on record | 1 |
| DASSHlocation not on record | 1 |
| Allentown, US | 1 |
| Banyoles, ES | 1 |
| Tallinn, EE | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Kingston, US | 1 |
| Irvine, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Philadelphia, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| KIRMlocation not on record | 1 |
| LfUlocation not on record | 1 |
280 institutions · 4 776 of 5 247 vouchered records shown · 418 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA32 detections
Where the DNA of Cytisus scoparius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found32
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 32 detections have coordinates
Open the map6 countries0
in semi-natural habitat along river sideIntroduced and escaped along roadsides; an e…Chamise & Ceanothus chaparral, granitic and …Roadside.Roadside weed.rock outcrop
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 7.70–18.5
Seasonal swing summer↔winter14.4 °C
Max temp (day)17.5 °C 10.0–24.2
Min temp (night)10.5 °C 4.20–13.5
Precipitation75.8 mm/mo 38.3–90.2
Air humidity61.8 % 57.7–64.7
Moisture balance-28.0 mm/mo -69.0–16.9
Vapour deficit589 Pa 396–841
Wind speed3.50 m/s 2.10–6.00
Cloud cover41.3 % 37.0–49.6
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.