Cytisus proliferus

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cytisus

At a glance

Occurrence records47

Data sources12

Biological traits29

DNA specimens0

eDNA detections0

Sources12 archives

Databases and archives Cytisus proliferus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF47 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

01Narrative

Cytisus proliferus, tagasaste or tree lucerne, is a small spreading evergreen tree that grows 3 - high. It is a well known fertilizer tree. It is a member of the Fabaceae (pea) family and is indigenous to the dry volcanic slopes of the Canary Islands, but it is now grown in Australia, New Zealand and many other parts of the world as a fodder crop.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology9

Fruit length45 mm

Fruit width12 mm

Leaf length20 mm

Leaf width9 mm

Petiole length1 cm

Plant height1.5 m

Seed length4 mm

Seed mass22.55 mg

Seed width3 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering endJun

Flowering startJan

Life spanperennial

Lifespan years4 years

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climberself-supporting

Elevation max2 000 m

Elevation min700 m

Epiphyteterrestrial

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree · TRY: Shrub

Leaf formpinnate

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry4

Leaf n12.84 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)10.11 mm²/mg

Wood density645 mg/cm³

03Chemical composition7 compounds

Compounds documented for Cytisus proliferus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenethylisoquinoline alkaloids6

Quinolizidine alkaloids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-2-Demethylcolchicine	present	NPASS
2-Demthyldemecolcine	present	NPASS
2-hydroxy-N-[(7S)-3-hydroxy-1,2,10-trimethoxy-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-7-yl]acetamide	present	NPASS
3-Demethylcolchicine	present	NPASS
Colchicine	present	NPASS
Demecolcine	present	NPASS
Sparteine	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytisus proliferus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ160654.1 ↗614 bpSpain · 2021

ACGT

TTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAA …

Chamaecytisus proliferus subsp. proliferus bio-material JBCVC:DNABANK C1096 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cytisus proliferus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–522n range48median48mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 484×CCDB · iber-fl · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants +1

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.

CCDB · book-atlas-flowering-plants

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

2n 522×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — HORJALES, M. 1975. Numeros cromosomicos en genisteas II. Trab. Dept. Bot. Univ. Complutense 7: 43–50.

CCDB · book-ipcn75-78 — Horjales 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor13

Museum / vouchered34

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 12≤1 km 1

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 6≤10 km 2

8 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	4
Moscow State Universitylocation not on record	3
Cape Town, ZA	2
Museo Achille Folettolocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Pretoria, ZA	1
San Jose, US	1
Claremont, US	1
Stockholm, SE	1
Jena Microbial Resource Collectionlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Frankfurt am Main	1
Auckland, NZ	1
BClocation not on record	1
Karlsruhe, DE	1
MeiseBGlocation not on record	1

16 institutions · 24 of 34 vouchered records shown · 10 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)