Cytisus oromediterraneus

Rivas Mart. et al. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cytisus

At a glance

Occurrence records19 408

Data sources10

Biological traits17

DNA specimens9

eDNA detections9

Sources10 archives

Databases and archives Cytisus oromediterraneus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 408 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF19 408 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Cytisus oromediterraneus, le Genêt purgatif ou Spartier purgatif, est une espèce de plantes à fleurs de la famille des Fabaceae. C'est un sous-arbrisseau trouvé en Europe et en Afrique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology4

Plant height1 m

Seed mass10.3 mg

Seed mass max10.3 mg

Seed mass min10.3 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsubshrub or shrub

Life spanperennial

Lifespan years31.25 years

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytisus oromediterraneus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections9

The DNA barcodea real sequence read deposited for this species

ITSDQ289666.1 ↗571 bp

ACGT

AATTTGTTTGACTACTCGGGGGTGGGCTAGAGGTGTTCGACACCCCTGCCCCCCTCGTGTCGGGAGGCGCCCACCCTGCGTGGTCTCCTC …

Cytisus oromediterraneus voucher MAF164361 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cytisus oromediterraneus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · mediterranean

CCDB · mediterranean

n 232×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

CCDB · CromoCat 2015 — Cubas, P., Tahiri, H. & Pardo, C. (2001). Karyological and taxonomic notes on Cytisus Desf. sect. Spartopsis Dumort. and sect. Alburnoides DC. (Genisteae, Leguminosae) from the Iberian Peninsula and Morocco Bot. J. Linn. Soc. 135(1): 43–50

n 241×CCDB · CromoCat 2015

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type19 408 records

Wild obs. + sensor19 066

Museum / vouchered340

Cultivated / captive2

Origin

Native18

Range

Area of Occupancy AOO16 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 3 159≤1 km 2 462≤10 km 11 069>10 km 132

16 822 georeferenced · 2 244 without coordinates

Open the mapobservation + sensor19 066

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 31≤1 km 116≤10 km 62

209 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence340

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	76
Entomological Society of Latvialocation not on record	51
València, ES	28
CICYTEXlocation not on record	25
Salamanca, ES	17
Museo Achille Folettolocation not on record	16
BClocation not on record	14
Madrid, ES	13
College of the Atlantic, Museumlocation not on record	10
Wlocation not on record	10
Santiago de Compostela, ES	7
Alicante, ES	7
Universidad del Pais Vasco (UPV/EHU)location not on record	6
ISAlocation not on record	6
Vitoria, ES	3
Granada, ES	3
Gijón, ES	2
Boumlocation not on record	2
Pamplona, ES	2
South Kensington, GB	2
Bourges, FR	1
Montréal, CA	1
Jaén, ES	1
BRNUlocation not on record	1
Muséum Henri Lecoqlocation not on record	1
IPE-CSIClocation not on record	1
JBAlocation not on record	1
San Sebastián, ES	1
OLAlocation not on record	1
Madrid, ES	1

30 institutions · 310 of 340 vouchered records shown · 30 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Cytisus oromediterraneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cytisus oromediterraneus

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type19 408 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type19 408 records