Cytisus filipes

Webb · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Cytisus

At a glance

Occurrence records39

Data sources7

Biological traits20

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Cytisus filipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF39 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

01Narrative

Cytisus filipes là một loài thực vật có hoa trong họ Đậu. Loài này được Webb miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length max45 mm

Fruit length min15 mm

Leaf length max10 mm

Plant height1.5 m

Plant height max5 m

Plant height min2 m

Life cycle & reproduction6

Dehiscencedehiscent

Flower colourwhite

Flowering endApr

Flowering startJan

Life formshrub

Life spanperennial

Habitat & environment8

Climatesubtropical

Elevation max800 m

Elevation min200 m

Fruit colourblack

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: e N

Leaf formelliptic

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytisus filipes has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLPV870680.1 ↗150 904 bp

ACGT

TTATTATATTATTATGTTATTTTTTTATATTTTATATAAATTTCTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATC …

Cytisus filipes voucher 20060051*D-Royal Botanic Garden Edinburgh chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Cytisus filipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Cusma Velari, T. & L. F. Chiapella. 1994. Karyological studies of Spartocytisus Webb & Berth. (Genisteae---Fabaceae). Stud. Geobot. 14: 33–39.

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

n 241×CCDB · Cannon, 2015

CCDB · Cannon, 2015 — Cusma Velari, T. & L. Feoli Chiapella, 1994

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type39 records

Wild obs. + sensor28

Museum / vouchered10

Other1

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 11≤1 km 6≤10 km 1>10 km 2

20 georeferenced · 8 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	3
Santa Barbara, US	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
University of Stellenboschlocation not on record	1
Montréal, CA	1
Wlocation not on record	1

6 institutions · 10 of 10 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)