Cytinus sanguineus — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cytinaceae/Cytinus

At a glance

Occurrence records250

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cytinus sanguineus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility250 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF250 records

DNA & barcodingNCBIsequences

01Narrative

Cytinus sanguineus is a species of parasitic plant in the family Cytinaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.15 m

Plant height min0.02 m

Life cycle & reproduction2

Life formholoparasitic perennial

Life spanperennial

Diet & foraging1

Parasiteobligatory

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 065 m

Elevation min45 m

Epiphyteterrestrial

Growth form detailedherb

Woodinessnon-woody

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cytinus sanguineus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392108.1 ↗554 bp

ACGT

TCGATACCTGCACAGCAGACCGCGAACTCGTTTTAATACACTGGGCTCGTTGTGTGGGGGTAACTCCTCAGCGTGTCGCTCTCTTGCATG …

Cytinus sanguineus voucher Muasya & Zhigila 7990 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type250 records

Wild obs. + sensor205

Museum / vouchered45

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 143≤1 km 24≤10 km 4>10 km 6

177 georeferenced · 28 without coordinates

Open the mapobservation + sensor205

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 45 records without

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	24
Pretoria, ZA	18
Cape Town, ZA	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	1

4 institutions · 45 of 45 vouchered records shown