Cystopteris fragilis
(L.) Bernh. · speciesAt a glance
Occurrence records137 719
Data sources11
Biological traits35
DNA specimens51
eDNA detections43
Sources11 archives
Databases and archives Cystopteris fragilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility137 719 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics51 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources35 traits
Chemical compositionLOTUS13 compounds
Occurrence & distributionGBIF137 719 records
Environmental DNA1 datasets · 14 countries43 detections
DNA & barcodingBOLD · NCBI51 specimens
Genome at a glanceCCDB · GoaT11.1 Gbp
01Narrative
Cystopteris fragilis, la Cystoptère fragile est une espèce de fougères de la famille des Cystopteridaceae et du genre Cystopteris.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology6
Leaf mass91.9 mg
Leaf size1 970 mm²
Plant height0.3 m
Plant height generative0.24 m
Plant height max0.5 m
Plant height min0.1 m
Life cycle & reproduction10
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typewind
Flowering endAug
Flowering startJun
Life formperennial or lithophyte
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max5 100 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeother
Growth formherb
Habitat GIFTcalcareous and schistose rocks
Leaf formelliptic
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)248 mg/g
Leaf n33.34 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)38.01 mm²/mg
⚠ sources differ — TRY: 38.01 mm²/mg · LEDA: 21.4 mm²/mg · GIFT: 21.4 mm²/mg
Other traits1
Diaspore typespore
03Chemical composition13 compounds
Compounds documented for Cystopteris fragilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Carotenoids (C40, β-β)4
Plant xanthones3
Cinnamic acids and derivatives2
Carotenoids (C40, β-ε)2
Carotenoids (C40, ε-ε)1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| 3,8-Dihydroxy-2,4,6-trimethoxyxanthone | present | LOTUS | |
| 5-O-Caffeoylshikimic acid | present | LOTUS | |
| [(E,2R,3R,4S,5R)-9-(3,4-dihydroxyphenyl)-1,2,3,5-tetrahydroxy-6-oxonon-8-en-4-yl] hydrogen sulfate | present | LOTUS | |
| [(E,2R,3R,4S,5R)-9-(3,4-dihydroxyphenyl)-2,3,4,5-tetrahydroxy-6-oxonon-8-enyl] hydrogen sulfate | present | LOTUS | |
| beta-Carotene | present | LOTUS | |
| Isomangiferin | present | LOTUS | |
| Lutein | present | LOTUS | |
| Lutein 5,6-epoxide | present | LOTUS | |
| Mangiferol | present | LOTUS |
05DNA & barcoding51 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cystopteris fragilis has left across the world's sequence archives.
At a glance
DNA specimens51
Marker genes8
GenBank sequences10
eDNA detections43
Countries15
The DNA barcodea real sequence read deposited for this species
CGATTGACCTATTACACCCCCGAATACAAGACCAAAGATACCGATATCTCAGCAGCCTTCCGAATGACCCCACAACCCGGAGTACCAGCT …
Cystopteris fragilis isolate SW11 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcL-like★rbcLa★trnL-F★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Cystopteris fragilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size11 070 960 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Cystopteris fragilis11.07 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 168 n = 84
Ploidypolyploid inferred
Chromosome records126–3362n range168median168mode58records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 16844×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Cytotaxonomy of spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lve, A. & E. Kjellqvist.Lagascalia2(1): 23-35(1972).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1517
CCDB · fl-europaea — Manton, 1950
CCDB · ipcn-api-dl — Love, A. & D. Love. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — Obermayer, R., I. J. Leitch, L. Hanson & M. D. Bennett. 2002. Nuclear DNA C-values in 30 species double the familial representation in pteridophytes. Ann. Bot. (Oxford) 90: 209–217.
CCDB · book-ipcn72 — LOEVE, A., & E. KJELLQVIST. 1972. Cytotaxonomy of Spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lagascalia 2: 23-35.
CCDB · book-ipcn75-78 — Love & Love 1976
CCDB · book-LoveLove1977 — Manton 1950
CCDB · book-LoveLove1977 — Wagner 1955
CCDB · book-LoveLove1977 — Vida 1974
CCDB · book-LoveLove1977 — Love & Love (in Love 1976)
CCDB · book-LoveLove1977 — Britton 1953
CCDB · book-LoveLove1977 — Bir (in Mehra 1961b)
CCDB · book-LoveLove1977 — Love & Love 1961a
CCDB · book-LoveLove1977 — Sorsa 1961
CCDB · book-LoveLove1977 — Sorsa 1962
CCDB · book-LoveLove1977 — Blasdell 1963
CCDB · book-LoveLove1977 — Britton (in Fabbri 1963)
CCDB · book-LoveLove1977 — Wagner (in Fabbri 1963)
CCDB · book-LoveLove1977 — Britton 1964
CCDB · book-LoveLove1977 — Bir (in Love 19670)
CCDB · book-LoveLove1977 — Bir & Shukla 1967
CCDB · book-LoveLove1977 — Taylor, R. L. & Mulligan 1968
CCDB · book-LoveLove1977 — Bir 1971b
CCDB · book-LoveLove1977 — Love & Kjellvist 1972
CCDB · book-LoveLove1977 — Smith, A. R. 1974
CCDB · book-ipcn73-74 — SMITH, A.R. 1974. Taxonomic and cytological notes on ferns from California and Arizona. Madrono 22: 376-378.
CCDB · CromoCat 2015 — Britton, D. M. (1953). Chromosome studies on ferns. Amer. J. Bot. 40: 575-583.
CCDB · CromoCat 2015 — Brownlie, G. (1958). Chromosome numbers in New Zealand ferns. Trans. Roy. Soc. New Zealand 85: 213-216.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1972). Cytotaxonomy of spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lagascalia 2(1): 23-35.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 484-487.
CCDB · CromoCat 2015 — Vida, G. (1974). Genome analysis of the European Cystopteris fragilis complex. I. Tetraploid taxa. Acta Bot. Acad. Sci. Hung. 20: 181-192.
CCDB · CromoCat 2015 — Wagner, W. H. & D. J. Hagenah. (1956). A diploid variety in the Cystopteris fragilis complex. Rhodora 58: 79-87.
CCDB · CromoCat 2015 — Wagner, W. H. (1955). Cytotaxonomic observations on North American ferns. Rhodora 57: 219-240.
CCDB · CromoCat 2015 — Queirós, M. (1991b). Estudos cromossómicos em Pteridophyta de Portugal. II. Collect. Bot. (Barcelona) 20: 23-33.
2n 25210×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · fl-europaea · CCDB · book-LoveLove1977 +1
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · fl-europaea — Manton, 1950
CCDB · book-LoveLove1977 — Blasdell 1963
CCDB · book-LoveLove1977 — Manton, Lovis & Vida (in Vida 1974)
CCDB · book-LoveLove1977 — Manton 1950
CCDB · book-LoveLove1977 — Vida 1974
CCDB · CromoCat 2015 — Vida, G. (1974). Genome analysis of the European Cystopteris fragilis complex. I. Tetraploid taxa. Acta Bot. Acad. Sci. Hung. 20: 181-192.
CCDB · CromoCat 2015 — Wagner, W. H. & D. J. Hagenah. (1956). A diploid variety in the Cystopteris fragilis complex. Rhodora 58: 79-87.
CCDB · CromoCat 2015 — Wagner, W. H. (1955). Cytotaxonomic observations on North American ferns. Rhodora 57: 219-240.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 3363×CCDB · book-LoveLove1977 · CCDB · CromoCat 2015
CCDB · book-LoveLove1977 — Bir (in Mehra 1961b)
CCDB · book-LoveLove1977 — Bir 1971b
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 1261×CCDB · Cave1963
CCDB · Cave1963 — Blasdell 1963
n 8432×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +5
CCDB · iber-fl — Estudos cromossmicos em Pteridophyta de Portugal. II. Queirs, M.Collect. Bot. (Barcelona)20: 23-33(1991).
CCDB · iber-fl — Notas cariolgicas e fitogeograficas de algumas Pteridophyta de Portugal. I Queirs, M., J. Ormonde & I. Nogueira.Acta Bot. Malacitana13: 121-140(1988).
CCDB · ipcn-api-dl — Haufler, C. H. & D. E. Soltis. 1986. Genetic evidence suggests that homosporous ferns with high chromosome numbers are diploid. Proc. Natl. Acad. Sci. U.S.A. 83: 4389–4393.
CCDB · ipcn-api-dl — Kurita, S. 1986. Chromosome studies on South American pteridophytes (1). In: Contributions to the Botany of the Andes. (II) 47–67.
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · ipcn-api-dl — Queiros, M., J. Ormonde & I. Nogueira. 1988. Notas cariológicas e fitogeograficas de algunas Pteridophyta de Portugal I. Acta Bot. Malac. 13: 121–140.
CCDB · ipcn-api-dl — Rasbach, H. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Queirós, M. 1991. Estudos cromossómicos em Pteridophyta de Portugal. II. Collect. Bot. (Barcelona) 20: 23–33.
CCDB · ipcn-api-dl — Queirós, M. 1998. Estudos cromosómicos em Pteridophyta de Portugal, III. Collect. Bot. (Barcelona) 23: 73–77.
CCDB · ipcn-api-dl — Bir, S. S., C. K. Satija, P. Goyal & S. M. Vasudeva. 1979--1980. Further studies on the distribution and taxonomy of Cystopteris fragilis (L.) Bernh. from the western Himalayas. Phyta, J. Soc. Pl. Taxomomists 2–3: 62–66.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — BIR, S.S. & P. SHUKLA. 1967. Cytology of some north Indian ferns. Cytologia 32: 24-30.
CCDB · book-ipcn67-71 — BIR, s.s., 1971. Cytological observations on some Indian species of Cystopteris Bernh. Nucleus 14: 56-62.
CCDB · Cave1956supp — Wagner 1955
CCDB · Cave1958 — Brownlie 1958
CCDB · Cave1962 — Sorsa 1961
CCDB · Cave1963 — Britton in Fabbri 1963; Wagnei in Fabbri 1963; Sorsa 1962
CCDB · CromoCat 2015 — Bir, S. S. & Shukla, P. (1967). Cytology of some north Indian ferns. Cytologia 32: 24-30.
CCDB · CromoCat 2015 — Bir, S. S. (1971). Cytological observations on some Indian species of Cystopteris Bern. Nucleus 14: 56-62.
CCDB · CromoCat 2015 — Blasdell, R. F. (1963). A monographic study of the fern genus Cystopteris. Mem. Torrey Bot. Club 21: 1-102.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1961b). Some chromosome numbers of Icelandic ferns and fern-allies. Amer. Fern. J. 51: 127-128.
CCDB · CromoCat 2015 — Manton, I. (1950). Problems of cytology and evolution in the Pteridophyta. Cambridge
CCDB · CromoCat 2015 — Mehra, P. N. & S. P. Khullar. (1974). Cytotaxomomy of W. Himalayan ferns. II. Bull. Panjab Univ. 25: 135-178.
CCDB · CromoCat 2015 — Smith, A. R. & J. T. Mickel. (1977). Chromosome counts for Mexican ferns. Brittonia 29: 391-398.
CCDB · CromoCat 2015 — Sorsa, V. (1961). Chromosome studies in Finnish Pteridophyta, II. Hereditas 47: 480-488.
CCDB · CromoCat 2015 — Sorsa, V. (1962). Chromosomenzahlen Finnischer Kormophyten, I. Ann. Acad. Sci. Fenn., Sér. A 58: 1-14.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
CCDB · CromoCat 2015 — Queirós, M. (1991b). Estudos cromossómicos em Pteridophyta de Portugal. II. Collect. Bot. (Barcelona) 20: 23-33.
n 1268×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · book-ipcn65 — Manton & R. 1965
CCDB · ipcn-api-dl — Manton, I., J. D. Lovis, G. Vida & M. GIBBY. 1986. Cytology of the fern flora of Madeira. Bull. Brit. Mus. (Nat. Hist.), Bot. 15(2): 123–161.
CCDB · book-ipcn67-71 — BIR, s.s., 1971. Cytological observations on some Indian species of Cystopteris Bernh. Nucleus 14: 56-62.
CCDB · book-ipcn67-71 — 70-309
CCDB · CromoCat 2015 — Mitui, K. (1970). Chromosome studies on Japanese ferns (4). J. Jap. Bot. 45: 84-90.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · iapt — IAPT/IOPB Chromosome Data 26
n 1681×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — BIR, s.s., 1971. Cytological observations on some Indian species of Cystopteris Bernh. Nucleus 14: 56-62.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type137 719 records
Wild obs. + sensor111 500
Museum / vouchered24 672
Cultivated / captive17
Other1 530
Origin
Native9 749
Introduced82
Range
Area of Occupancy AOO243 048 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 30 045≤1 km 18 821≤10 km 46 101>10 km 1 811
96 778 georeferenced · 14 722 without coordinates
Open the mapobservation + sensor111 500
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 2 327≤1 km 4 590≤10 km 4 626>10 km 1 311
12 854 georeferenced · 11 818 without coordinates
Open the institutions mapphysical evidence24 672
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 11
11 georeferenced · 6 without coordinates
Open the mapnot free-living17
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions254 of 477 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 962 |
| LDlocation not on record | 825 |
| Helsinki, FI | 737 |
| Institute of Plant and Animal Ecology Ural Branch of the Russian Academy of Scienceslocation not on record | 518 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 503 |
| Provincia di Livornolocation not on record | 498 |
| BIO-UNIPIlocation not on record | 461 |
| Olocation not on record | 454 |
| Zürich, CH | 436 |
| Zürich, CH | 416 |
| WTUlocation not on record | 397 |
| Trondheim, NO | 381 |
| Salzburg, AT | 370 |
| Chicago, US | 369 |
| Bronx, US | 351 |
| Philadelphia, US | 335 |
| Université Lavallocation not on record | 330 |
| Moscow, US | 297 |
| MAlocation not on record | 274 |
| TROMlocation not on record | 270 |
| St. Paul, US | 269 |
| Pullman, US | 264 |
| MeiseBGlocation not on record | 262 |
| Victoria, CA | 258 |
| Vancouver, CA | 252 |
| Bergen, NO | 243 |
| Saint Louis, US | 242 |
| Québec, CA | 222 |
| Durango, MX | 222 |
| Wuzhou, CN | 199 |
| Herbario Universidad de Concepciónlocation not on record | 197 |
| Uniwersytet Wrocławskilocation not on record | 193 |
| Tsukuba, JP | 178 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 177 |
| Claremont, US | 174 |
| Durham, US | 164 |
| Corvallis, US | 159 |
| KMNlocation not on record | 158 |
| SLU Artdatabankenlocation not on record | 155 |
| Beijing, CN | 152 |
| Missoula, US | 150 |
| University of Alberta Museumslocation not on record | 150 |
| Oskarshamn, SE | 145 |
| BClocation not on record | 144 |
| Garðabær, IS | 140 |
| Oulu, FI | 138 |
| Kuopio, FI | 137 |
| Tartu, EE | 135 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 131 |
| McWane Science Centerlocation not on record | 130 |
| Adam Mickiewicz University in Poznańlocation not on record | 128 |
| Denver, US | 122 |
| Berlin, DE | 119 |
| Riverside, US | 118 |
| Madison, US | 117 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 117 |
| University of Calgarylocation not on record | 114 |
| Minia, EG | 110 |
| Chongqing Museumlocation not on record | 108 |
| Mexico City, MX | 106 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 105 |
| València, ES | 105 |
| US | 104 |
| Barcelona, ES | 104 |
| Wlocation not on record | 100 |
| Ann Arbor, US | 99 |
| BDBClocation not on record | 97 |
| Burlington, US | 93 |
| University of New Hampshirelocation not on record | 92 |
| Boise, US | 91 |
| Turku, FI | 90 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 90 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 89 |
| 87 | |
| Philadelphia, US | 87 |
| Angwin, US | 86 |
| Arcata, US | 86 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 85 |
| Acadia Universitylocation not on record | 84 |
| Provo, US | 84 |
| Chapel Hill, US | 83 |
| CJBGlocation not on record | 81 |
| San Sebastián, ES | 80 |
| South Kensington, GB | 80 |
| Görlitz, DE | 80 |
| GMBAlocation not on record | 79 |
| CASlocation not on record | 72 |
| Logan, US | 70 |
| BFLlocation not on record | 70 |
| Shinshu Universitylocation not on record | 68 |
| Entomological Society of Latvialocation not on record | 67 |
| Austin, US | 67 |
| Wellington, NZ | 65 |
| Flagstaff, US | 64 |
| BRNUlocation not on record | 61 |
| Vitoria, ES | 60 |
| New Haven, US | 60 |
| Montréal, CA | 60 |
| San Diego, US | 59 |
| Tacoma, US | 58 |
| Urumqi, CN | 58 |
| Santa Barbara, US | 58 |
| National Biodiversity Institute, Costa Ricalocation not on record | 58 |
| Jyväskylä, FI | 55 |
| Irkutsk State Universitylocation not on record | 54 |
| DOI/NPS, Greenbelt Parklocation not on record | 54 |
| Caldwell, US | 53 |
| Uppsala, SE | 53 |
| EEZA-CSIClocation not on record | 53 |
| Frankfurt am Main | 52 |
| Urumqi, CN | 50 |
| University of Silesia in Katowicelocation not on record | 49 |
| GJOlocation not on record | 49 |
| Paris, FR | 49 |
| Tallinn, EE | 49 |
| Toronto, CA | 48 |
| Auckland, NZ | 47 |
| Pocatello, US | 45 |
| CICYTEXlocation not on record | 44 |
| Albuquerque, US | 44 |
| Chadron, US | 43 |
| ASUlocation not on record | 43 |
| Kew, GB | 42 |
| Portland, US | 42 |
| WINlocation not on record | 39 |
| Bozeman, US | 38 |
| Bern, CH | 38 |
| Fort Worth, US | 38 |
| Glarus, CH | 37 |
| Morgantown, US | 37 |
| Ciudad de México, MX | 37 |
| Davis, US | 36 |
| TUR-Alocation not on record | 36 |
| Madrid, ES | 36 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 36 |
| Philadelphia, US | 34 |
| Saint John, CA | 34 |
| Tampa, US | 32 |
| Salamanca, ES | 31 |
| Xiamen, CN | 30 |
| Orem, US | 29 |
| Udmurt State Universitylocation not on record | 29 |
| Fredericton Stock Culture Collectionlocation not on record | 29 |
| SZUlocation not on record | 28 |
| Yukon Universitylocation not on record | 28 |
| Odawara, JP | 28 |
| Guatemala City, GT | 27 |
| USFS/BHSClocation not on record | 27 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 26 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 26 |
| Kandalaksha State Nature Reservelocation not on record | 26 |
| Durango, US | 25 |
| Yangling, CN | 25 |
| MEXUlocation not on record | 24 |
| Anchorage, US | 24 |
| Aarhus, DK | 23 |
| Dekalb, US | 23 |
| Karlsruhe, DE | 23 |
| University of Stellenboschlocation not on record | 23 |
| Calabar, NG | 22 |
| Institute of Biology Ufa Scientific Centre of Russian Academy of Scienceslocation not on record | 22 |
| San Isidro, AR | 22 |
| Bloomington, US | 22 |
| Christchurch, NZ | 22 |
| San Luis Obispo, US | 22 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 21 |
| Mlocation not on record | 20 |
| Green Bay, US | 20 |
| University of Lethbridgelocation not on record | 20 |
| PRClocation not on record | 20 |
| Pittsburg, US | 20 |
| EL PASO, US | 19 |
| Ashland, US | 18 |
| Miami, US | 18 |
| Granada, ES | 18 |
| US | 18 |
| Brookings, US | 18 |
| Lubbock, US | 17 |
| Canadian Department of Agriculturelocation not on record | 17 |
| Lincoln, US | 17 |
| Cheney, US | 16 |
| Keene State Universitylocation not on record | 15 |
| Uniwersytet Śląski w Katowicachlocation not on record | 15 |
| Millersville, US | 14 |
| Universidad Nacional de Colombia (UNAL)location not on record | 14 |
| Juriquilla, MX | 14 |
| NMBU:MINAlocation not on record | 14 |
| Henderson, US | 14 |
| Weber State Universitylocation not on record | 13 |
| Tuxtla Gutiérrez, MX | 13 |
| Whitehorse, CA | 13 |
| Phoenix, US | 13 |
| Xian, CN | 13 |
| AASlocation not on record | 13 |
| Stockholm, SE | 13 |
| Bandelier National Monumentlocation not on record | 12 |
| Dresden, DE | 12 |
| La Paz, BO | 12 |
| Taipei, TW | 12 |
| Mexico City, MX | 12 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 12 |
| Montréal, CA | 12 |
| Trois-Rivières, CA | 11 |
| Guasave, MX | 11 |
| BSBIlocation not on record | 11 |
| Santiago de Compostela, ES | 11 |
| Rocky Mountain Biological Laboratorylocation not on record | 11 |
| Austin, US | 10 |
| Rovaniemi, FI | 10 |
| IFR-DNFlocation not on record | 10 |
| IPDNlocation not on record | 10 |
| Sucre, BO | 10 |
| University of Wisconsinlocation not on record | 10 |
| Autlán de Navarro, MX | 10 |
| Xining, CN | 10 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 10 |
| PrivatHerblocation not on record | 10 |
| Giardini Botanici Hanburylocation not on record | 10 |
| AUAlocation not on record | 10 |
| Spearfish, US | 9 |
| Davenport, US | 9 |
| Universiti Sains Malaysialocation not on record | 9 |
| Bourges, FR | 9 |
| College of the Atlantic, Museumlocation not on record | 9 |
| Frauenfeld, CH | 9 |
| GZUlocation not on record | 9 |
| San Angelo, US | 9 |
| Porrentruy, CH | 9 |
| Brussel, BE | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| FLADlocation not on record | 8 |
| Tromso University Museumlocation not on record | 8 |
| Jaén, ES | 8 |
| Taipei, TW | 8 |
| Nanjing, CN | 8 |
| University of Southern Mississippilocation not on record | 8 |
| Tianjin Natural History Museumlocation not on record | 8 |
| University of Winnipeglocation not on record | 8 |
| Dhaka, BD | 8 |
| IWEP FEB RASlocation not on record | 8 |
| Sevilla, ES | 8 |
| Canadian Museum of Naturelocation not on record | 7 |
| Durban, ZA | 7 |
| San Francisco, US | 7 |
| Durham, US | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| nbflocation not on record | 7 |
| Cusco, PE | 6 |
| CJBNlocation not on record | 6 |
| BG-NMNHSlocation not on record | 6 |
| Knoxville, US | 6 |
| DBF-NHMDlocation not on record | 6 |
| ISAlocation not on record | 6 |
| Copenhagen, DK | 6 |
| Northridge, US | 6 |
| Mississippi State, US | 6 |
| Uniwersytet Warszawskilocation not on record | 6 |
| San Jose, US | 5 |
| KIRMlocation not on record | 5 |
| Nunoa, Santiago, CL | 5 |
| Columbia, US | 5 |
| Alicante, ES | 5 |
| Hobart, AU | 5 |
| Santa Cruz, US | 5 |
| HJAEFlocation not on record | 5 |
| Appalachian State Universitylocation not on record | 5 |
| Antiguo Cuscatlán, SV | 5 |
| Canberra, AU | 5 |
| QCNElocation not on record | 5 |
| Santa Cruz de la Sierra, BO | 5 |
| Long Beach, US | 5 |
| Pamplona, ES | 5 |
| Lausanne, CH | 5 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 5 |
| Cochabamba, BO | 5 |
| Tilburg, NL | 5 |
| Dublin, IE | 5 |
| Badajoz, ES | 5 |
| Gijón, ES | 4 |
| New Brunswick, US | 4 |
| Tyumen State Universitylocation not on record | 4 |
| Forssa, FI | 4 |
| San José, CR | 4 |
| Corrientes, AR | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Arequipa, PE | 4 |
| Irvine, US | 4 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| Johnson City, US | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| CBDClocation not on record | 4 |
| Muséum Henri Lecoqlocation not on record | 4 |
| Namur, BE | 4 |
| Pamplona, ES | 4 |
| Whitewater, US | 4 |
| Williamsburg, US | 4 |
| US | 4 |
| Science Museum of Minnesotalocation not on record | 4 |
| Bend, US | 4 |
| Saint Petersburg Universitylocation not on record | 4 |
| VALElocation not on record | 3 |
| Boumlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Muzaffarabad, PK | 3 |
| H-AkrKGlocation not on record | 3 |
| Podgorica, ME | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| OLAlocation not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 3 |
| Culiacán, MX | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Tapachula, MX | 3 |
| Grand Junction, US | 3 |
| Fulda, DE | 3 |
| USFSlocation not on record | 3 |
| Tsitsin Main Botanical Garden Russian Academy of Scienceslocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Cambridge, US | 3 |
| Kurgan State Universitylocation not on record | 3 |
| Tomioka, JP | 3 |
| Maryland Department of Natural Resourceslocation not on record | 3 |
| HUT Culture Collectionlocation not on record | 3 |
| Staten Island, US | 3 |
| ULBF-AGRlocation not on record | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| US | 3 |
| Edinburgh, GB | 3 |
| UFPRlocation not on record | 3 |
| Porvoo, FI | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| H-Schuhwlocation not on record | 3 |
| Chengdu, CN | 2 |
| Obihiro Centennial City Museumlocation not on record | 2 |
| University of Salzburglocation not on record | 2 |
| San Francisco, US | 2 |
| University of Helsinkilocation not on record | 2 |
| Puebla, MX | 2 |
| Waverly, US | 2 |
| Northeastern Forestry Universitylocation not on record | 2 |
| NMWlocation not on record | 2 |
| Seoul, KR | 2 |
| STNFlocation not on record | 2 |
| Truckee, US | 2 |
| Santiago, CL | 2 |
| Chapingo, MX | 2 |
| Nanchong, CN | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Chicago, US | 2 |
| Bratislava, SK | 2 |
| Yaoundé, CM | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Facultad de Biología, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| INFlocation not on record | 2 |
| Mexico City, MX | 2 |
| Mohonk Preservelocation not on record | 2 |
| Buenos Aires, AR | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| KNFSClocation not on record | 2 |
| GB | 2 |
| Fargo, US | 2 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 2 |
| HAWlocation not on record | 2 |
| Sion, CH | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Tobolsk Complex Scientific Station of the Ural Branch of the Russian Academy of Scienceslocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Ciudad de México, MX | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Tempe, US | 2 |
| BAYLUlocation not on record | 2 |
| UnBlocation not on record | 1 |
| SEFlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Cape Town, ZA | 1 |
| University of Hulllocation not on record | 1 |
| GINRlocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Fribourg, CH | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Guilin, CN | 1 |
| Kunming, CN | 1 |
| UTPLlocation not on record | 1 |
| Hamilton, US | 1 |
| Toluca, MX | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Universidad Nacional Autonoma de Mexicolocation not on record | 1 |
| Allentown, US | 1 |
| Herb. BBGlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Zhengzhou, CN | 1 |
| MFMlocation not on record | 1 |
| Universidad de Orientelocation not on record | 1 |
| Portland, US | 1 |
| IEBlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Komarov Botanical Institutelocation not on record | 1 |
| TAIElocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| NoColllocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Tlalnepantla, MX | 1 |
| Instituto Tecnológico de Huejutlalocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| KNFHClocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Oswego, US | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Nagano City, JP | 1 |
| Altos de Pipe, VE | 1 |
| Central Sibirian Botanical Gardenlocation not on record | 1 |
| Instituto Politecnico Nacional, Mexicolocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Los Angeles, US | 1 |
| Córdoba, AR | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| CUVClocation not on record | 1 |
| Fullerton, US | 1 |
| Mount Annan, AU | 1 |
| Brisbane, AU | 1 |
| HUPCHlocation not on record | 1 |
| Castelar, AR | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Wuhan, CN | 1 |
| Tampere, FI | 1 |
| HUAlocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| München, DE | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Calvin Collegelocation not on record | 1 |
| PTHlocation not on record | 1 |
| WAGlocation not on record | 1 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 1 |
| Pretoria, ZA | 1 |
| Morelia, MX | 1 |
| Smithfield, AU | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Iquitos, PE | 1 |
| STUlocation not on record | 1 |
| Kingston, US | 1 |
| Göteborg, SE | 1 |
| UChlocation not on record | 1 |
| Macomb, US | 1 |
| BMlocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Coimbra, PT | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Xinxiang, CN | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| sxphclocation not on record | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Russellville, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
477 institutions · 23 023 of 24 672 vouchered records shown · 1 601 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Cystopteris fragilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys1
Countries14
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map14 countries0
crevises of the rocksBy creek 45% slope.alpine calcareous moist scree and grasslandRiparian vegetation with Salix spp., Quercus…Humid temperate forestTrinity College Botanical Gardens, Growing i…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.0 °C 2.20–17.2
Seasonal swing summer↔winter24.7 °C
Max temp (day)15.2 °C 4.50–23.2
Min temp (night)7.80 °C 0.2–12.2
Precipitation79.6 mm/mo 35.1–163
Air humidity60.2 % 52.7–67.2
Moisture balance-25.2 mm/mo -79.6–125
Vapour deficit567 Pa 296–899
Wind speed3.20 m/s 2.30–5.80
Cloud cover50.7 % 30.9–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 41 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.