Cyrtostylis tenuissima

(Nicholls & Goadby) D.L.Jones & M.A.Clem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cyrtostylis

At a glance

Occurrence records35

Data sources7

Biological traits23

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Cyrtostylis tenuissima's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cyrtostylis tenuissima, commonly known as dwarf gnat orchid or dwarf mosquito orchid, is a species of orchid endemic to Western Australia. It usually has a single more or less round leaf and a flowering spike with up to fourteen small, green flowers with a greenish brown to pinkish, wedge-shaped labellum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length17.5 mm

Leaf width17.5 mm

Plant height0.2 m

Plant height max0.2 m

Plant height min0.05 m

Life cycle & reproduction6

Flowering timennnnnnnnyyyn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeorbicular

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtostylis tenuissima has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY135374.1 ↗687 bp

ACGT

ATCATTGTCGAGACCCAAAAAAGATCGAGAAACTCAGATAACATGTGAATAATCTATAAAAGTGGCGGTTCTTTCGTCGCGAACGCTCAT …

Cyrtostylis tenuissima 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type35 records

Wild obs. + sensor2

Museum / vouchered33

Origin

Native3

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 3≤1 km 6≤10 km 18>10 km 3

30 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	16
Canberra, AU	8
Museo Entomologico de Leonlocation not on record	5
Mount Annan, AU	3
Adelaide, AU	1

5 institutions · 33 of 33 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cyrtostylis tenuissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)